GenePrediction:GLEAN_5979 Details

Name: GLEAN_5979
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:756085..753994 (- strand)
Length: 2092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:756085..755915 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_82:755841..753994 (- strand)
Length: 1848
>GLEAN_5979 class=GenePrediction position=GCSC_82:756085..753994 (- strand)
ATGTCTTTTCTAGGCGGTGCCGAGTGTTCTACGGCAGGCAACCCGCTGAGCCAGTTCACAAAGCACGTCCAGGATGACAG
GAGCTTGCAGAGAGACCGGTTGGTGAACGGCGGCCAGAATGGGTCACTGAGTGGCTTCCGAAGCGCGGGCCCGAACATGG
CCCAAGACGAGGTAAGTTTTCCGCCGCTGCTCTGCTCAAGACGGATGTAGGACAATTCTGACGATGTGCTCACCTTGGCT
TTAGATGGTCAACGGCTTTCTGCAACAAGGCCCCAACATGCCGGAGATGAACATGGAGCCGGGACACCCATCTCTCAGCC
ACCAGCTCGCCATGGATCCGGCACGCGGCGTGCATCTTCGTGCACAGTCCGGCTCGCCAGCCTGGGCGGACAACTTCCAC
GCCCCGGCACCGATGAATGCGGCATTCAGCCCCGACGATTTTGCCAATTTTCAGCAGCAGCAGCAGCAGCAGAACATGCT
CCACCAGCAGTCACAACAGCCGATGGCACCGTCGCCTCTCACGGCGGCCGGCCCTTCGCATGCTCCGGCGGCAATGGGAA
TGAACGGCATGGCCATGGGTCCAGGACCGATGAACATGGGCATGAACTCGATGCCGTACATGATGTATCGGCAGAACATG
CAGGCAAACTGGACGCAGCCACAGTTCCGGCCTCCTTCGACGTTCCAGCAGGAGGGCCAGAGGGCGGCCGAGGGCAAGGG
CAAGGGCAAGGTGGTGGAGCTGGACGACCACCAGTGGGAAGAGCAATTTGCACGGATGGAGATGCACGACCAAGGCGCGG
CCGAGGAGTCAGTGCAGAAGGGAAAGACGGAAGAAGCGCAGGCCGAGGCAGCGATAGAGCGTGAGCTGAACCAGATGGAC
GAGAAGCTGCTCCAGCCGGAAACTGATTTTGGCGATCTGGAGGCGGTATGGAACGGAATCCAGACGGAGAAATCGGCGAT
GCGGTCGGCGTTTGGCGAGGAGGACTGGAAGGACGTCAGCGAGACATACAAGAACTGGAACAGCGAGTGGGAACCGCTCA
ACTACCGGATGGGCATGGACCCGCGGATTGATCCGTACCAGTTCGAGGAGGACAACCTTTTCCAGGCACAGAACAACCCG
TTCGAAGAGGGGGTGCGGATCATGAACGAGAACGGCAACCTGTCGCTGGCGGCGCTGGCGTTTGAGGCGGCGTGTGCACG
GGAGCCGGGGCGGGTGGAGGCGTGGGTGTACTTGGGATCGGCGCAGGCGCAGAACGAGAAGGAGACGGCGGCGATCCGGG
CGCTGGAGCAGGCGTTGAAGCTAGATCCGACGAACCTGTCGGCGCTGATGGCGCTAGCGGTGTCGTATACGAACGAGGGC
TACGACACGACGGCATACCGGACGTTGGAGCGATGGCTGTCGGCCAAGTATCCGCAGGTGCTGCCGCCGGCCGAGTTGTC
GTCAGCGGCCGACGTGGGCTTTACGGACCGGCAGCAGCTGCACGACGGGATCACGGAGCGGTTCATCCAGGCGGCACAGC
TGTCGCCTGACGGCGAGCATATGGACCCAGACGTGCAGGTGGGCCTGGGCGTGCTCTTCTACGGGGCGGAGGATTTTGAC
AAGGCGGTCGACTGCTTTCACGCATCGCTGGCATCGAGCGAGCAGGGCTCGAGCAACCAGCGGTCGCAGGTCCATCTGCT
GTGGAACCGGCTGGGCGCAACGTTGGCTAACTCGGGCCGGTCGGAGGAGGCCATTGCGGCCTACGAAAAGGCGCTGTCGC
AGCACCCCAACTTTGTGCGGGCGCGCTACAATCTGGGTGTCAGCTGCATCAACATGGGCTGCTACGAGGAGGCGGCTAGC
CACCTGCTGGCGGCGCTGGCCATGCACAAGGAGGTCGAGAAGAGCGGCCGGGAGCAGGCGCGTGAGATTCTGGGCGGTGC
AGCTGGCGGCGTGACCGACGAACAGGTCGACCGCATGACCACGCAGAATCGCAGCACCACGCTATACGACACGTTGCGGC
GCGTGTTTGGGCTGATGGACCGGCGGGATCTAGCCGATAGGGTGGCGGCGGACATGGATCCGGATTCGTTCCGGAATGAG
TTTGATTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62