GenePrediction:GLEAN_5981 Details

Name: GLEAN_5981
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:745917..745241 (- strand)
Length: 677
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:745917..745744 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_82:745677..745436 (- strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_82:745373..745241 (- strand)
Length: 133
>GLEAN_5981 class=GenePrediction position=GCSC_82:745917..745241 (- strand)
ATGCTGCCGCTCAGACAACGGGCCGCGTGTATGGCGCGGCAGGCTCGTCTGCGGCCTGTCATGCCCGCCTCCCGCGCCTC
CCGCGCCTTCGCCTCGACCGACAGCCACTCCCACGATCACCACGATCACCACGACCGCCACGATAGCCATGCCTCTGTCG
ATGAGCCAATGGGCGTATGTGTCCTCCATCCACTTGCTCGCATGTCGCTTGATTCTGTCTAACCGCGTATCCCGATGCAG
AAGGGCTTTTACGTCGCCCTGGCCGCCATTCCCGCTACCTGGATTCTCTACACCCTGAAGAACTCTGGCAAGGACGGCCA
GCCCACCGCGCTCGAGTCCTACTTCAGCAAATTCGACTACTTGACCGAGCAGTGGGAGGTCCGCAACACCCTCCGCACCG
CAGCCATCGAGCAGGCTACCCACGATCGCATTCTGCTGCAAACCGTTCCCCGGAACTCTCAGGTTGACCTGCGCTTCCCA
GAGTACGTCCCCCTCTCCACTTGCTATCATGCTCTGCCTTTGCGCCCACAATCTGACTGGCTAGGGTCTTCCAATCCGGC
TCTCCATACAACGTGCCCGCAGGGCACGCCGTGAACCTCAACCATGTCGTTGCCCACTACAAGGACCAGCACTACAAGGA
GACTGAGCGGCAAGCTAAGGCGGCTGCAAAGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62