GenePrediction:GLEAN_5984 Details

Name: GLEAN_5984
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:735307..722775 (- strand)
Length: 12533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:735307..734909 (- strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_82:734834..734225 (- strand)
Length: 610
Type: CDS
Source: GLEAN
Position: GCSC_82:733972..733642 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_82:733551..733171 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_82:732879..730491 (- strand)
Length: 2389
Type: CDS
Source: GLEAN
Position: GCSC_82:730022..729825 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_82:729753..729676 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_82:728994..728940 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_82:728528..728346 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_82:727878..727853 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_82:727508..724057 (- strand)
Length: 3452
Type: CDS
Source: GLEAN
Position: GCSC_82:724005..722775 (- strand)
Length: 1231
>GLEAN_5984 class=GenePrediction position=GCSC_82:735307..722775 (- strand)
ATGGGCGAAACCGCCGAGCCTAAGCATTCTAGGCCATCCTCATCCAAGCGGTCTTATTTGTCGCGCAAGTTCGCCCGACA
AGTGCAGGATGCTGCAGATGGCAGCAAAGGACCTTTGGGCCTCCACTGTGTTTATTCTCCTAAGGACGCTATTGTCGACC
TCATTTTCGTCCATGGTCTGAACGGTGGTTCTTACAGTACATGGAGAAATGGAAGCCATCAAGAAAACTTTTGGCCACAG
AAATGGCTGCCGCAAGATGAAGCGTTCAGCGATGTCCGTATTCATACGTTTGGATACGCATCTTCCTGGGGCACTGAGTC
AGTCCTCAACATACACGACTTTGCTATGTCGCTTCTTGCAGCAATCGAGGACTCTCCTGAAATGGGCTATGATTCACAGG
TGCGCTCCCAAATAAGACGAGAGTCGCCTTATAGACATGATCACTAGTCTCATCTTAAGTACGGTCTCGATAGGCTCCAA
CGCGCTTTATTTTTATAGCCCACAGCATGGGTGGACTCGTTGTGAAGGAAGCATTTATCATAGGCCATCGCGACCCTCAG
TTCAAGCACATCGTCGACCGGGTCAGCACGATTCTCTTCCTTGCCACACCACACAGAGGCGCCTCCCTGGCACAGACGCT
GGCCCGTTTGGGGACCATCTTACCCGGGCAACGGCCGTTTGTTGGCAGTTTAGTGCCCCGGTCAGAGAGGCTTCAGTTCA
TCAATGAGGAGTTTCCAAGGCTCTGCGGCGATTTAAAGCTAGTGTCATTCTTCGAAACGAGACCTATGAACTTTATAACG
AATCTCATCGTGGACAAAGAAAGCGCAGTGATGAATGTCCCGAACGAGCGCAGAACTCCTCTCAACGCAAACCATCGCAA
CGTTGCCAAGTACACTTCTACCAATGACCCAACTTACATCACCGTGCGCAATACATTGGCGAAATTAGTCTCCCCCCATC
GCAATCCAACACGGGGATGGAAGAATGGCTTGAATCAGGAAGACACACGTGTTTTGAGCACGCTCCTGAGCCTTACGGGA
GAGCCTGACGATATCATCATGCAGGACCAGCAGAGGCTTCCTGGTACATGCCGATGGCTGTCTGGCATCGAGGCTTACAG
ATCTTAGAGAGAAGCTCGGAACTCAACCTCTTTGTGGATTTGCGGCCGTCCTGGAGCTGGAAAGAGCTTTCTTTCTGGTC
ATACTGTCAAAGAGCTTCGCGATCAAGGTGCCGACACCTGCTTCTTTTTCTTCCAGTCTGCCGACGCCGCAAAGGCAACA
GCTAATGCATGTCTGCGATCCCTTGCGTGGCAAATGGCTGCGATGCATCCTCAAGTGTATGCTAGCATCAAGAATGTGGC
GGCAGGGTTGGATGATGACCGCATAGACACGGTGAATCCTAATCCTGTTTGGAGAAGACTGTACCTCTCTGGTATTCTAC
AGGCCAGGATTAACAAGCCGCAATTCTGGGTCATAGATGCTATGGACGAGTGCAAAGAGAGTATTGATATGATGAGCTTC
CTGTCTCGTATCCAAGAGTACTGGCCGGTTTCAGTCCTCATAACATGCCGCGACCCAGTCGACAGGCACCGAGGAAATAT
GATAACGTTGCCCGACATCGAGTCTTACACCATCGAGGACAAGGACAACGAGCAGGATATAGCTATGTTTGTCGAATCAC
AATTACACAGACTTCCCGAATTTCACACAGTGGAATGGCCTAGTCAATCAGACATGGCCTCCCACATTATCGACAGATCC
GGAGGCTGTTTTCTTTGGGCGTCCCTGATATGTTCGAGTTTGCAAAAGGTGGCTAGCGAAAAAGAGGCGAAAGCGGTTAT
GGAGAGTGTACCATCCGATATGGATGCACTCTACAGCAGAATCTTCAACGACATGTCCGCCAGCTCGCTCGGAAAGGATT
GCGCAAGAGCCGTTATTATTTGGACTGCTTATGCACTCCGACCATTGACAACGACCGAAATGAAGGAACCCATCGAAATA
GATCTTCAAGGTTCCATTATTCTTGTCGCCGATACCATAAAACGGAGTTGTGGACAGATCGTATATGTGGATTCGCAAGA
AAAAGTGCGCTTCGTCCACTCCACAGTCAAGGAGTACATCACTGCCGAAACGACCAGGTCAGAGTTCGCAGTGACAAAGA
CCGAAGGCCATCGACATTTGGCCTTGGTGTGCCTAGAATATCTCATAGGCAAAAGCAAGGTTGCACCCAGAGCCAGAAGG
TTCAGCTCAAATCAACAAGCTGACGGAGAAGGAACAAGCAGGCGTCAGCCCTTTATTTCTTCTACAGGCTCGAATCATCT
TTCATACGCCTTCAAAGAATATGCAAACACGTTTCTATTCTCGCATCTAAACCATGTGCACTCGAATGACGATGAGGTTT
TGGCTAAGCTTGTACAATTTCTTAGCAGCCATAGTGTCCTTCACTGGATTGAGTTTTCTGCGGAACATGGAAACCTGCGA
ACAGTCTATCAAGCAGGGAAAACCATCATTTCAATGATGGCTCGGCGGGCACAGCAGCCGCCGCCAACAAGTTTGGCAAG
CCGCCCATTTTCCATGCTGGAGAAATGGGGGGACGATCTGGTACATCTAGCCACCAGATTTGCGCGCCGACTAAAAGACA
ACCCCCAGGCCATTCACCATTTGATACCTCCATTTTGCCCCCCAAGCTCCGTCATTCGACAGCAGTTCGCAAAATTGAAC
CGCGTCAGTGTCCATGGCATTTCTGCTCGAGAATGGGACGACTGCCTCACTACAATTACGTACGATCCGGGTGCGAAGCC
GAATGCTATTGCGGCTGGGTCGGGGCTGTTTGCCGTTGGGATGATGACACCGGCCGGAAAGGTCATAGTGTATGATGAAG
TCATATTCCAAGAGGTCCACGTTTTGATGCACGGCGAACCGGTGTTTCGTCTAGCACTTTCGAAGAACGGGGATTTGCTT
GTCTCAGCTGGATCGAGATCCGTTCGAATCTGGGCTTTGAAGGACGGAAAACCACTGCAGCACATCCACATATCGTCCCT
CTGCCTTGCACTTGGGTTTGCCGAAGACGACAGTATTTTGTGGGTGGCGACCAAACAAAATCAAATTTACGAATGGGATG
TGACAAAAGGGTGTCTTATCGATGTGAGCACTTGGACCAAGGATCTTAAGGATTCGATGCAGTCTCGGACACCGACCATG
ACATCCTTTCTGTTCCCCAAGAACGTCTTATGCGTGATCTACAGGGGAGAGAAGTTGCTTCTGTGGGACTTCAAACTCGG
CGAAATCTACGACATATATGGGAAGGAATCAGCAGTTTCTCTGAGCGAGGACAGAGCGATAGATGCTCGTGCAATATCAT
TGAGCTATACCGATACCAATGGCAGCCGAATCGCCGTAACATACACAGATGGCGATTTAGTGTTGCACGACATGGATGAG
GGCAAGCCAACCCGTGTGGCCAGAAGAATGAACGCCATGGCACTAGCCTCGTCTCCTGATGGCCGAACGCTGGCAGGGGT
AGACTCCGAAGGAAACTTTACTCTGTTTGAACTGGAAACGCTGCAGGTCCTTTATCGAGTGCGGTTCACCACCCAGATGC
TGCCAAAGTGCATGACGTTTTCAGCCGACAGCGAGAGATTCATCGAGATCAGTGGAAATCAGTGCCGAGTGTGGGAGCCC
ATCGTGCTGCTCCGGCCAGATGCTTCTGAAATTAACAGTGACACGCTCTCTGTTTCCAGTGGGCCTCAAGAAATTGAGTT
CCAGCCGAATTTTGGAGTGAGTATCACCGCCATGGTCTGCTGTAGGAGTGCAAGTGTGGTATTTTGCGCGATGGAAGACG
GATCGGTACATGTTTACGATATCAGCGTGGAGCCGAGGGGTGAGAAGTTGTTCACACAGACGACGGCGTGCACAATCCAT
CTTCTCTACCTGGACGAGATGGACGAAGGGTCGCCCATGATTCTTGCTAGCGGCGACGAGTCTGGGCGTACCATGGTGTG
GCCAGTCAGTCGGCGAAGTCCACATAGTCAGACCGGCTGGACTGTCTCGGCTGAGCCTCTGATCGACGCCAAGGCCTCAG
CTCTTGGGGTTCTGAGGCAAGTGTTGGTGTCTAGAAATCACGACATGCTCCTCACATGTACGGACCAGTATGATACTCTG
TGGCCGGTGCCGAAACAGGGCGAAGGCATCTGGGTGGCCCAGGAGATGGGTGTCAGCAGCCATCCAAGCTGGCTGCAACA
CCCTTTGAAGCCAGAGCTTCTCATCTGTGTTTCTGCATCGCAATTGAGAGTCTGCCGCTGGTCGGACCTTAGTGTCGTTC
GTTCAATCGACATCACCCTCAATGGAACGTTTCATCAGCTGGCACCTCTTCATCATCAAAAGTATTTTGCTACAGTCTCG
GAATGCAAATCGCCTTCCTCTACAAGCCAGACCAAGCGGCCGTGTTTCATACAATTGTGGGATTTCAACGGACTTGAGGG
CTCTGTCAACCGGATGGAGCCTGTCTGTGAAATTGACGGCACTGGAACGAATGCAGACTTTGTCATCGGTGCTTTTGAAT
CCCGAATGGTCCTCAGTTCCGACGATTACTGGATCTCATCGGTGAAGCTTGGGATTTCGATGGCTGATTTGCCCTGTACA
AGGCATTTCTTCGTGCCAGATGACTGGGCCAATGCCTACTTCAAGCTCGTCATGGGTATTGGCTCAAACGGCGAGATCCT
TGTTGCAAAGCAGTCAGAGTTGATCGTGATCAAGGGCGGCTTGAAAACGACTGAGCAAGGAAAGGCCTTCTTCCCGCCCC
GAGGCAACAACATGGAAGTCCTGCACACTAGAGGAAAGTCACTTGGAGCAGCTATGAACCTGCTAAGTTAAGGCTCGCTG
AGTCCTCCTGTGCGAAATGTTTGGCGCGAGAAAAAACGGGCTGAGATCTACGGATGAGCTTGGCGTACTATGTATCCAGT
TTTTGGCATAATCTTGGGATGATGGAGAGGTGGTTTTTTCAGGCTAGGAAGAGAAGGTTGATACAGAGAACAGAAACCGA
CAGAGCTTAGATGACGATATCATTGCTGACAAAGCGGTTTAAGCCGGACGACTGAACAGACTGACAAGTAGACCAGCCAG
ATAATCAGAAAAGACTACGCTCTGTGGCACTTCTTGATATGTAAGATACGTCATTTAACACTTATACGCTCCAGCCGCAA
AGTTAGTGTATTGCGTGACAGCGGAGAGCTGCATGGCGGATATCCCCATCCATAACGAACACGCAGAGCTGCGGTACGCC
GACAGAAATGGTGTCTCATGTCTGAGGCTGGAGAGTGGCACAAGGCGTTTCTGCCGGACATCGGCATGTTTCGGACAAGC
CTTGTAGAGATTGACACGGGACACGATCATACGACGTATCTCGCATCTTTTGGCTTCTGCCTGCACTCTGCTCAGAGCAG
CCTTTCATCTCTTTGGGCCAATTTCCGGAGCAGCCGCCGATCGGTGGACTTGCCTTGGGCTCGTCTTGGCTGTCAAGCCA
CCAGTCCTTTCAGATGCCTCTGCAAACCTGCCAGACTCAGGCCGAGACGTCTTGCCAGCACACCGTCGCCGACTGGCCGG
CGATGTGTCTGTGCGTGCCAGCGCAAATGGCGGTCTGTGGCGGAAACGGAACCAACAAAGAAAACACGATCAACAGCCGA
AAGCCTCCACGTGGGAGGATGTTGCATCCAACCGCAAATTTGCTCGTACTTACTTTCGACATCCTGCCAGCACTACATAG
TATGGTAGTAGCAGGTACAAATATTACAGAGTACATATCTCCTTCAGGGGCAGATCCGAGATCGATCCAGCTGGCAGCAA
ACGCTTTGATGAAGTGTGGAGGCGCCCGGCTTCTTCACATCTGTTGGGGAAATCAGGGAGGCCTTCCTATCGGTCTTTTT
GCTTCCCAGGCTAACCCGTCGACCAGGGTGAAATTAGGCGCACTCACCCTTCTCTCCTCCATACGGAGTACATAGTAATA
CGTAGAGTAAATTAGCCTTATTAACCTAGCAAAGGGGAATCGTGCAGACAAACTCGGCCAATTTAACAGTACGGAGTAAG
ATAAATTCCATCCGTCGGCTGCTGGCCAGGAGCAAGTCGAAAAAAGGAAGCAGAGGGGTAGAAAAGCACGACGAGGCATG
TGGGAGCAATACAGAGTACGAAACAACGCAATACCAGCGCAGAACGGACACATTTCAAGCAGCCCGGCCTACATAACTCA
GGCCGTCTTTGTCATCAAGTATGACATCTACACGTTATAGCGCCGGCGCTGGCTAACGCCTAACAAGCCCTAGCTGAGCG
CCCAGCGTCACATCCCAGGGCACGCTAGTCCAGTGAGCCGTGTCCGATGTAAGATTCATAGGAGTATATACTCGTAAGAT
GCACGCAGTAAAGCTATTCGCTGTGACCCAGGAGGTTACATTGCTTCTATTACCCCGTAACGTCCAGCTGGCCCGGGATC
GCTACGGAATATAGTGTGCATGCCCGTTTCTCTCTTCCTTCTATGGAGCATCCGGCCGCGGTGTCTTGCGCCATTCGCCC
TCGTATTTCACATTGCATGTACTTCGTAGCCTCGATGGCCAATTCTCCATGGGCTCTGCCACAAACCGGTTCTGCCCCTT
ACTACTCTCATAGCTAAGATTTATTATTGCCGCCCCCCTTTGCACGGCATATCCCACTTTGCTGCAAAACGCTAGCTCGA
TCGTCCCTACCCATTTTGCAGGCGCCGCACCACCGCTAACTGTTCACGCTCTAGGATAGGGCCTTCTCTCTTCGGCCAAA
CTGCCGCCGTCGCCTGTCTCCTCTCCCCCTCATCATCACCATCGCCGGCTTCTCTCGTTTTCTTCTCCTCTCGCACCACC
GTCTCCGGCCTCTCCCGCGCTCGCTCGCTCGCTTCCGACCTGCCGCCTCTCTCGTTTTCTTGGTTCATTGTGCCCTTTAA
ACGTCCCCGAAGTGTCTGCTCCGTACGGAGTGCTCCCTACCCATCTTTTCTACCCCCCCCTGGGCGTTTCACAGGTCAGT
CGGTTATACCAAGAGCGATAATATGCAGCCTGCTCTACCCTCAACCACATACACGGAACAATCTACCTCTGCCAAGGCGG
GTGACATTCGACCAAATGCTTCCATAGACCCGTGTTTCACGGGCCTCTGCACTCTGTCATTAATATTGAAGAGGGGCCGC
GGTGGAAACATGATATTAACAGCCGATCATGACAGGGCCGCCCATCCATCATCATCCATAAACGAGAGGTCAACCGGCAG
GGTTACTTCGTCCCGTTCCAACAGCACAGCCGAACAGCGGCTCTGCCTTGCTGCGTCACTGTGCTTCTTGACCCTTCCCT
TCGCCGAGTGCTCCGCGCCTAATCAGTAATTCATTGCTTGCACACCGCCCGAACATTCTCTGCCGGCAGAGACGCACAAC
GAAACGCTGCTTCGGGTCCGTTCATATTATCGAGCGGCATGCAGTGAGACTGGAGCCGGGGCGGAGCTTTTTTCTTTCTC
TTCTAATATCCCCTCGTACTTTCTTATCTCGTTCGGCCATTGCTGCCTTGTTCATTCTCCCGTTTTGCCTCTTGCCCTTC
TTCGTTTCCGATATTTCCTGTCTCTTTTCAGCCCTTTTGTCCCGGCCCCGAGCTTGCCCTCGTCCGGCAAGCTCAGCTTG
CCCGCACTTGCACTTGCATCTGCATCGACTTCGCTGTTGGCTGTTGGCCATTGGCTGCGTTGCATTAACTCCCACGCTCA
GACACCACGCCCTGAGTATTACGCCCCAACCAATTCTAGCCTCCGCAACAGGAGCCTGAATTGCATTGCAGCAAGACGCC
AGGGCCCTTGTCCACGACCCGTTATTTCATACCCGGCCATGAGATGAGCGGTTCCACGCGGTCGATGGCTCCGGCCGTCG
AATCATCACATTCCACACACTTCCCCCGGTCTCACTCGACGCCCAACCTTCTACTTCTAGGCTCTCCGGCCAAACAACCA
CTCCCCCACCACACATCAGGCTCTACAGCCACAACGTCAGCACCAGTACCTAGCTCACCACTCTCCTCTTCAACCTACGC
CAACTTTCCCGACAAGGGCTTACCCAGCCTGCCCGCTTTTGACGTGCCCTCGTTTGACTTCGGTTTGGATTTTAACACTG
AACTTGGGGCTTCGCTGCGCGGAGACCAGAACAAGGCGATACCGGACAATCCGACCGCAGTCGATGCTGCACGCAAAGTT
TGGCAAGATTTTCTCATCAAGGATGATATAGACGGTGCAACCGAGACAGACCGAGCTACAATTGCTTGTGCAAGTGTTTT
GAACAGCGACCGGTCATCCGGCGACATCTACGCAAGCACTGCCGGCGCTCGTGTCAGTGCTACCGCAACCATTCCCAGTC
GCACTAGAGAAGCCTTGCCCTCGATCACCAAGACGGGCAAACCTACGCGGGCTGTCGAAGCAGAAGCTCGTCGGAAACGA
AGCCTGATTGACAGGCCAAGATCTTGGATTCACAGCTCGAGGTCTACGCCAAATTTGCGGAACTCTCTGGAAAACGACCA
AGGATTCCGACAAGCCGCAGTGGCTGTGCCGGTGGCGGCGGCTAGAGGGACTGACAGATATGTTGGTGCTGTTGATGCTG
CTGCCTTGTCCACACTAGACAAAGCGGTCACGACAGGCGAACCGATGGGCGAGCGGTCGCGAACTATGTCCTCATCGTTT
GCCGACTTCGCAAGGCGCCCGTGGATTTCGCGATCGCCCTCGCCCTCGCCACCAACCAAATCAACGCCCACGCAGAAAAA
GACACCGGCAAAAAAGGCCGACGACGGCGACGATTCCAACGGTTTCCGTGGAAAGCTGTCGCTCAAACGCCTGGTGCCGA
CAGTAGCTGTGGTGGAGAATATTAGCGAAAAAGGGAGCGCAAAGCCGGCAGGTTCGAGTGAGAGCCCCAATAAAAGAAGG
GGAAGTGGGAGCGGAGCTGGAAGCAGTAGTGGTAGCGACGCGTCCGATGCCACAATTGGCCCAGCCGATGCGACGGCAGG
CGCCAATGGTGGTATCGTGACCACCGCATCTTCACACAGGCCCTTTAGTCGGGCTAGCGAGTACTTGACCCGCATGAGAC
AGCGCCCGCAAAGCATGTTTGTCAGATCAGACGTCGGCAGCCCGGGATTTACTGCCAGCATCAACAACGACCGAGATGAG
GAGGACGGCGACGTCGGCACAGACAGAGGTCCGCCGCTGATCAATTTGCCGCTGGATTTTCTTGCTGATGGCAGCGCGAC
GGCTCCAGGCCGCAGCTCTATGCAGACAGCAGAATCGTCTGGCAGCAGCACCCACGGCAGCAGCGCAAACGACAGCGCCG
TGCTTCCAGCCTCCGAGGCCGAGTCACTGACAACTGCCGATACCAGCCGGCACACAAGTCCCATGGCGCAGCAGCCAGCG
TCGCGCGATCCTCTTTGGATGGCATTTAAAGACCTGGAGGCCGCATTCTTCAAATTTCTCTCCAAACCGAGCACGGCACA
GCGCATGGGCCTAGTGCGGACGGCGCTTACCCCTTTCTTGCGCCGCTATGCTCTTGACAGCTCCAACAAAGATCTGAACT
TGCTCTCGCCTGAGGATGTCGAACGCCGCACCTCTATCCTCAACCGGTGGTGGACAGCCTTGTTGGAAATGCTGGACAGT
CCAAGGCAGTGGGATGGAGGCAACAACCGACAGACGGGCAACCAAACCCACTCACAATCGAGTAGCGGTGCTGTGCACTT
TCCTACGACAACTACGACTGTCACCAGCAGTATCTACCCCCTGTCGGGTGTCGACCGGCCTGCGGTGTTGGATGCCGTGT
CTATGATAATGCTGCGGCCGGAATGGCGGCTGCTCACCACTGTCTTTCAGCCGCTGGCTGATCGGCCGCCCAGCGATCCC
GTGCGTGCCCGTGCTAACACGGACGACATGCCACCAACCGAGGATGGGAGCTTCTTGGTCGAGGAGTCGGCGGAGCACAA
CATCCGCACGACGTTTATCAACAACCTGATGGCACAGCTAGCGTTCGTCGTGGAGAGAATGTCCATGCGCCAAGTGCCAC
ATTCCATTGTCAATTTCAGCGGCCGGGCCTGTGCCTACGCCTTCTTCTTTGTGCCTGGCGTGGCCGATATACTGGTACGC
CTTTGGGGGCTTGACAGACGTATTGACCTTGTCCGGCGCTCTGCCGATGCTTTCGGCCTACCACGCCGCAGCCGTGGCGA
AAGTGAGGATCTGATCGCGCTGTTCCCGCCCTGTCTCGGGCCTCTCGGGTGGCAGTCTGTGAGTGCTATCCACACAAGAC
TGCGCCGGCCACCTAAGATGAACCTGCTGCTCTCAACGTCTGCTACCTGCAGCCGCATCCCGTGGTTTGCGCCTCACTGG
CTCGCACGCTGGCGTGGTGTCGATACCGACCTGTTCTTCATCTTCAGCAAGTACTACTACATTCTTGCAGACGACTTCAT
GCCCGCGGTGCTTCATCTGCCGCTCGTCGAACAAGCCCGAGCCCCAGCCTATGTCCTCCTGCACGCCCAGCTGCTCCACA
TTCTCGACAACACCATTCATCGCCAGGCTGCAGTCGAGGCAGCTATAATGATGGCCGCCCCGCCCCTAGTGGATGGTGCA
TCGGCTGGCTCGGCATCCGGGACCGCCGATGCATTCGCCCCCCCCTTCCTCGTGCAACCCACACATAATCTGCTGCGGGA
TATGGGCGAGAATCGAGTCATAGCACTGCTAAATGACCTGCTGAGCACGGGCGAGTCGCTGGCAGGCGCTCGCAACACAT
ATTCGCAGTCTCTCATGACGCTTCTCAAAGCTGCTGCCGGTCGTACTTCGCAGTATGACCACAACGCATGCTATATGCTG
TGCGACTTTTTGCAAGAGATTTTCCAGGTGTTCGACGGCTACTATGGATACAGCAATGACGACGGCGGTGCCATTACGCC
ACCGCCTGTCGACCTCGTCGACTGGGCGTTCTGGCAAGACGTGTGCAAGATGATGCTAAACTCGAACAACACGATGTCAG
AAATCCGAGTGCTATCCTTTCTTTATACCGTTTGGGACATCATCACCACCGACGACGGGCGAAGGGAGGAGTTGTGCTTA
GGATGGCTGCTCACCGAGGATGTGTTCAGCAAGTTTTTCAACAACTGGTCTCCCATGGTTCGAGCGTATTACATGCGTCT
GCTGTGTTGGCGCATCTGCCGGGATTCGGGGAGCTCGAATGAGCTGGATATGTAAGACCCGTCCACCCTGCTCTATGTGG
AGGTCCATGCTAACAAGACCAGAAAAATCTATCTGCTTGTTTCTCAACGGCTGAAGACGGTTTGGTCACACTACTTGTGG
CTCAAGCAAAAGGCCGAGAAGGAGGCGACGCTCCCACCATCTACGGCGCCTGCGTTGCCACAACCGGGCAGACGTTTTAT
GATCGTTCGAACCGAGGTCAACGGCCCACAACTTGGCCTGATGGTTAACGGCAGTCGTGGCCAAGGCCGCGGGAGCACGA
GCGCGGCAGCTATCGGATTCGACACGTTAGCAAGTCCATACAGCGGCTTCGACGGCATAATTGAGATTCGTGACGGGACG
TCGGGCTCGAGGCCGAATTCGTCTGCGTCGGACGACAAGAAAGGCGACGGAAGCTCGACAAAGAAAAAGTGGTCTCTTCT
GGGCAAAGTGCTGAACCTAGCAAGCGGAAGGTCAGATACTACCGAGGAGCAGCCGGACAAACCACGGCGGGAACGGTCGT
TTGCAGGAACGATGTCTCTTCTTCCGCCGTCCAAATCAGGGCGGCTTGGTTCTGCATCGTCGGACTCAGGGTCGTCGACG
GGGTCGGCACCGGTGTTCGACAGCGCGCAATTTGTGTTCAAATTTATGCTACACAACATCCCGTGGCAGGGCCAGAGTGG
CGGGCCGATGGGGTCTCCGGGGGCGGTAATACTACCGCCGGTGTATCGGGACCGAGTGCTTACGCGTCCTCGTCTTCCGG
CACCGGCACAGGTCCGGGTCAGCTCTCGGCTCGCTCTTGCGGGCAGACTGTCTGGAAGCGTGCCGCCGGTTCCGGCTGGC
TCGCCGCCCATGACACGGCAGATCTCTGAGGCTGTGACTGGCGGGCTCGTGAACGAAGCCAAGAATGCCAATCCGACAGC
GTCGATTCCAAGTGACGACAGCTCCAGCGGCGGGACTCGGCCGCGTGGCGACAGCTGGGTATCGACGAGTTCTAGGGCGA
GCTCGCCGGCGGCCAGCGGAGGTGAACTGGATGCGTACTCGCGCAGCAACTCGCTGGAAGAGGAGTTTGACCGAGACCGG
GAGCGGGAGCGGGCAGTGGTGCAGCCGGCGGAGCCGATTGGATGCACGACACTGCTGCGAGCCAAGTATAGTGGGAAAGC
TTTGGCGGAGTGGAGTCTTGTAGTGAACGAGTGCAACTCGTTTGTCGACCGACGGCGGGACGAAGGCGTGTCTGCGCTGA
AGGACGTCGAGGTTCCTTGTCTCGGAATTGAGGGGCTGCGGCGGCTGAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62