GenePrediction:GLEAN_5985 Details

Name: GLEAN_5985
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:719686..717759 (- strand)
Length: 1928
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:719686..719618 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_82:719522..717759 (- strand)
Length: 1764
>GLEAN_5985 class=GenePrediction position=GCSC_82:719686..717759 (- strand)
ATGCCCCCGCGCAGGTCCCATAAGAAATCCAGGGCCGGCTGTCGTCGCTGCAAGTCGCGCAAGATCAAGGTGAGCCAGTC
CAGCTGCCAGGCTTCCACGATGCCAGAATGGCCACTCCCCCCCCCCCCCCTTGACATGGCCGCCCTCTTCTGACCGCTTT
CCAGTGCGACGAGGCTCGCCCGCGATGCTCCAACTGCGACAAGCATGGCGTCAATTGCGACTTTGAGTTTCCCGAACTCG
CCTCCGGCCTCTCGCCCAACGGCTCGCGCTCTCCCTCCGGCTCCAAGCCCGGCCTCACGCCCGTGACGAGACCCGCGTCC
TCCAGAGCGGCTTCCCGACTGGCTGCCCGCACCTCCTCTTCTACTGCTTCGACCGCCACACTCGGCCCCCCACCACCGTC
CCCCTCCTGCATGTCAGCTCTCACCGCCACCACGCCCTCCACCCCCGCCGGCCGCATTCTGGAGCTTCGTCTCCTCCATC
ACTTCACTACTGTCACTTTTAAGACGCTGTCGTCGTCCAACGAAAAGGTCCAGACCATATGGCGCGACTTTGTACCCCGC
GCTGCCTTTGCTGCCGCCAGTGGCTCCACGGCCACTGCCTCCAACCACCTGACTGACGGCATCTTGGCCATTGCCGCCCT
GCACCTACGCACCCTGGCCCCCCATGACCGCGAGCTGATCAGCGCCTCTCACGCCTACATGGCCTCGTCGCTCAGCGAGT
ACAATCGTCTCCTCAAGCTCGGCATCAACCCCTCCAACGCCGTCGCTCTCTTTCTCAACGCCGCCCTGATTGCCTTCCAG
TCGGCTGCTGCCCGCATCTTCAACAAGGAGGAGCCGGCCGTCAGCATTGCCGACATTGACGAAGCTGCCGCCGGCCTGGC
CGGTGCCGGTGCTGGCAATCCTTCCATCTCGCCTTCCTCTACTACTGCAAACTCCACATCCTCGACAACGGCTGCTGCCG
GCAACCCCGGCGCCTACGGCCTGCCCATGTCCTGGTTCCATGCCTTTCAGGGCGTCAAGACAATCACGGCGGCCTCATGG
CAATGGCTGCGCAGCAGCGACATTGTCCTGCCCATCATCAACGCCCAGCCCCCGCTGCACTTGGACATTGCTGCCGCACA
CGAGGGCTTCTTCGGCCACCTGCTCGACGGCCTCGACGAGGAGCTGACTGGCCTGTCCTGTACCGCCGGTGCCACCGGCA
ACGACGCCACGTGGACGCCCAAGTCGGTCTTTTCCTTTGGCCGGAGTCCGTTTACACAGAGCACATCGGCCACTGGCAGC
GAGTTTGATGGCTCTTCCAGTGCCGGGCTGGACGACGGCCAGGGCCGGTCTCGTGTGCTCGAGAGCCCGCCGATGAGCCG
TCTGGGCGAGCTCATGAACGAGAATCTGTTTGGTGAGGACGACGACGTGGCCCAGCGCACGCGGCACGCGTACCAACATG
CCGTTGCCGTGCTCAATTGGGCCCACAGCAGCCCTTATAACGGGGCTTGCCTGGTTTTCCCGGCCACGGTGTCGCGGCAT
TTTGTCGACCTGCTCGGCAGCCGGTCGTATAGGGCCATCACCATCCTGGCCTGCTTCTTTGCCATGCTGAAGACGCTCGA
TCGGGTCTGGTGGCTGCAGGGCATGGCGCGCCGCGAGGTGCTGGGCATCGTGTCCATGTTCAACTCGGACGCCATCCCGA
TGGACGTCGAGCGTCGCTGGTGGCCCCACGTGCAGTGGGCTGTGCGTGTGGCCCTGTACCACGACGACAACTCACCGACG
GACTATGTGCCGCCTGATGTCTGGGGCTGCTCGCCGTGCTACGACGTGCCGGAAAACGGCCAGACACATCGGGCGCCCGA
GAGTTTTGTGAGCCACATCGACATGGTCTCGGAGTCGATCAACGGTGGCGGGGCGTCGGTCGAGTTCAACTACCCCGGCC
TGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62