GenePrediction:GLEAN_5987 Details

Name: GLEAN_5987
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:705639..702199 (- strand)
Length: 3441
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:705639..704974 (- strand)
Length: 666
Type: CDS
Source: GLEAN
Position: GCSC_82:704901..703682 (- strand)
Length: 1220
Type: CDS
Source: GLEAN
Position: GCSC_82:703623..703463 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_82:703410..703209 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_82:703141..702789 (- strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_82:702587..702199 (- strand)
Length: 389
>GLEAN_5987 class=GenePrediction position=GCSC_82:705639..702199 (- strand)
ATGCTCTTCTGCGTCTTGAGCTATCCTGCCCAGATCGCCGCCGTTGTGGTTCCTTCTATCATCACAAAAAAATGGCTGGG
CCAGCAGGACTGCATGATCAGCTTTCTTTCTTGCATCTTGGTTTTCGGAATTCAGCTTGCCAATCTTTCCGATTCCGAGG
AGGTAGTCTGGTATCCTCACATTGGTCCTTATCTACTAGCTCTCATCTTTGAGCCAGCTCTAGAAATTATCTCACTGTCT
GCACGCGAGCCAGGGGCTCTGACAGCTTCCGAAACTGCACAGCTATGCGTTGTTGCATCTAGATATCTGGTTATCACTCT
GATTGTGGCCACCTATTTCTTTTCGAGAGACCCCCCGAAGGCAAATGGTAATGTAGATTCAGAGCAGCAACCACTCATCC
CAAAGAACAACAACGGCACGCCCAATGAAAATCTTGATGATTCGGCGGGCTCTCAGACCTCGCAGACCTCCGGTTATGGT
TCCACCACCAACAACTCTTCCTCCAGTAGGTCGACGTCAGATGAGGAAGCTGAGTCTGGCACAGCTTCAAACACAAAAAA
GGGCAACGAGTCAAGCTGGGAGCGCCGCGAGCGTGACGCCCGCGAGGGGATGGAGAAACGCCTGAAAGAGAACGGAAATT
GGCTAGAATATGCAAAGAGGTTTCTCGTAAGTTGGGTCACTCTTGATTGCGAAACTTGGCGGCTCACCGAGTTGTCCGAA
TTCTGACATGTTTTCCAGATCTTTATCCCGTACATCTGGCCTGTCGACAATCGTTCTCTTCAGGTCCGAGCCGTTCTCGT
CGGTGTTTGCCTGCTAGCCAATAATGTGCTCAATGTTTTGATGCCTCGTCAACTCGGCATCATTATAGACAGCCTCAGCC
ACGTCAACGGTAAAAATCCATGGATTCAAGTCATAATTTATGCTGGCCTCAAATTTTGTGGCTCGGAAGCCGGCCTTTCA
CTCTTGCGGCAGTGGCTTTGGGTGCCTGTCGAATTCTACTCGTTCGATGCCATGAGCACGGCGGCATACTCTCACGTCTT
GAATCTGTCGTCCGACTTCCATGACTCCAAGAGTTCATCCGACATTATGATGGCAATCACCTCTGGTCAAAGTGTCTCTA
ACTTACTAGAATCGATTTGTTTCTCCGCAATTCCAATGCTTATTGACATGTTCATCGCCTTTCTGTACCTATCGGTTACT
TTTGGTCCGTACGAGGGGTTCATCACTCTGGCAACTGCAATAATCTTCCTCTACATTGCCGGAAGAATGATTTCAGGGCT
CAAGCAGGCGCGGAGGAACGAAGTTAGTGCCTGGTTTGAGGAACACTACGTCCGCCAGGCCGGTATTCAAGGATGGTCCA
CTGTGGCTTCATTTAATCAAGTGAGCCACGAGGAGCAGCGCTATTCGATTGCAGTAAAGGATCGTGTGGCAAAGTCGCAA
GCCGTTTACTTTGGTTATCTGATGGCGTATGCTTTTCAGTACCTCGTCCTTCTTGCCGGGCTCCTGGCCGGTGCTTTCCT
TGCAGTTTGGCAAGTTACTTCTGGCCAAGCCACTCCGGGACAGTTTATCATGCTCCTCACCTACTGGACGCAACTAGTCT
ATCCCCTTTCTTTCTTTGCAAGTCTGGGAAAAAATATTTCCAGAAATTTCATTCAAGCTGAATCGCTCCTTGAAATCATG
AAAACAAAGCCGACGATTGTCAGCAAGGAAAATGCGTCGGAGCTGGATTTTTCTGGCGGCGCCGTCGAATTTGACCGCGT
GTGTTTTTCCTACAACGACAAAAAAGATATTCTCAAGGACATCACCTTCTATGCTCAACCTGGAACAACAATTGCCTTTG
TCGGCGCTACTGGCGCTGGAAAGTCAACGATTCTGAAACTGCTTGATCGCTTCTATGATGTCAGCGAAGGTTCTATCAAG
ATCGACGGGCAGGACGTTCGTGACGTGGAGCTCTACAGGTGCGTGTCATTTTGTATCTGTGCCAGTTATCAAGCTGCGTA
GTCTAATCGAACATAGCTTGCGCTCCCGAATCGGGATCGTTCCCCAGTCCCCGATTCTTTTCAACGACACTATCATGAAC
AACGTTCGCTACGCCAATCTGACTGCAACGGCTGAAGAAGTACATGATGCTTGTCGGGCAGCCTGCATTCATGACCAAAT
TCTCGGGTTCACCGATGGTATGCAATATGGCTCTCGATTTACTCACGCATTGCTAACGGCCTAAATTAGGATATGAAACA
AGAGTTGGAGAGCGAGGCGTCAAGCTTTCCGGTGGCGAGCTACAGCGGGTCGCAATCGCACGGGCTCTGCTCAAGAATCC
TTCCATTGTGATGCTCGACGAAGCAACTAGCTCTGTTGATACTGAGACAGAGCAAAAGATCCAAGAAGCCCTGCACGCCC
TGTGCCATGGCCGTACAACATTCGTTGTTGCGTATGTGTTTCCTTTTTCACTGTTGGGTTGCGGAATTCTCCGAAATATC
TACTAACGTGGAGCACAGTCACCGACTCTCGACGGTCATGAACGCGGACCGAATCATTGTTATCTCAGAAGGCAAAATAG
TTGAGCAGGGATGTCATGACGATTTGATCTCAGCAAACGGGAAATACGCAAGTCTGTGGTCGAAGCAAGTGTTCACAAAA
CCCAAAGAGAAGGCCAAGTCTCCGGTAGACAGTGTGCTTAATGTGCCGGATATTGTCAATGATCTCGATCCCGAAGTAAC
CAACTGCGAATTGGCCAAGGCTCAGAAAAAGACGACTGCAGAGACGCCAAGCCCGAATGGCGTCGATAAAGAGTCAGAGC
AAGCTCTCGACAGTGGCAAAGGCAAGGATATCGCCGTTCCCATAGAAGATGGTAATGTCAATATTTCTCGGACAGAGACG
GCAAACAAGATAAATACCCCCACCAGGACGACAAAGGAGGTAAGTCGCAATCAGCCAAAGGCGCGGAAAGCGGTATTGGT
TGGCTGTTTCTGACGTTTCAATCTCCAGGCTTAGGATGCCCGATTGAATCCTGTTGCACCAACATTCACACCTCGGCAAT
ACACTTCTGTAGCCCCTTCCAGCACCACTCACGTCGCCGCCGACTCCGAAGTCACAGTGGCGGAAGCTTTGCCATCTATG
ACGGAGAAAGACGGCCTTTCCCGGCGAAGTGATTACCGACGTCTCGGTGGAAGCAGGCATAATGACAGGACAGATTCCTG
TGAAGACTTGGGCGACCTGGCCCATGCTATAGATGCGGGTTCTTCGACCATCTCTGGGCGTTCTGGGTCCAACCGTGAAT
TGTCAGAAAGCCTACAGCGCAGCACTGACGCGACGGAAGCGGACGAGTCCCTAGAGATGGCAGCACCACAGGCACTGGAA
ATCAAGAGCCAGGCTGCTGCAGCAAACAACATCTCAACCGGGAGTGTGAAGAGCAGGCACAAATCCAGCAGGGTCCGGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62