GenePrediction:GLEAN_5989 Details

Name: GLEAN_5989
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:688905..683431 (- strand)
Length: 5475
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:688905..687269 (- strand)
Length: 1637
Type: CDS
Source: GLEAN
Position: GCSC_82:687194..685877 (- strand)
Length: 1318
Type: CDS
Source: GLEAN
Position: GCSC_82:685765..685512 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_82:684878..684330 (- strand)
Length: 549
Type: CDS
Source: GLEAN
Position: GCSC_82:684243..683831 (- strand)
Length: 413
Type: CDS
Source: GLEAN
Position: GCSC_82:683762..683431 (- strand)
Length: 332
>GLEAN_5989 class=GenePrediction position=GCSC_82:688905..683431 (- strand)
ATGGATCGTGATCATGACAGCTACCGGGGAAGGGGAAGCAGCAGGGACCATGACGGTGGACGAGAGCGAGAAGTTGATCG
TGAGACCTACAATACAAACTTCAAGCGCCGAAGATTGAACTTTACCAAGTCCCGTCACGACGATGACCGGTCCAATGGTG
ACCGATCGCAAAACTACGACCGATCGGCGACTCCACGAGGCCGGCGCGGAGACTCGACGCCTATGAGACGGGACCCTGAA
GCATCGGAAGCTCCTGACGAAGATGACGCCGCGCTGGATCGTGATTGGTACACAGGAGACGAATTTGGTCATACATTTGG
AGACGAAGACCACAACCCGTTCGGCTCGTTCGACGACAGGACATGGGACGACAAGGAGACCCAGGAGAAGGCACAGTTTG
AGAGGAAGGTCGGCCGGTTCGATCGCGTGAATCCACGCGCCTTGCAGAAGCAACGGGATGTGGACGCATGGGAAACGAAT
CGGATGCTGACGAGTGGCGTGGCCCAACGACGGGATATGGGAGACAGCTTTGATGACGAGGAAGAGGCCATGCGTGTGCA
CCTCTTGGTACACGACTTGCGCCCGCCATTCCTGGACGGCAAAACCATCTTCACGAAGCAGCTAGACCCAGTGCCAGCCG
TTCGAGACTTTCAGAGCGACATGGCCGTATTCAGCCGAAAGGGCAGCCGTGTTGTGCGAGAGCGGAGGCAGCAGAGAGAG
AGGCAGCGTGCTGCAAAGGACGCGACCGCCATGGCCGGCACAACCCTTGGCAATATCATGGGCGTCCACGAAAACGGCGA
CGCCGACGGCGACAGTGCGGTGCCGGTGCCTGGCGAAGAGAACGGCAATGCTACTGCAGAAGGGTCTTCCAAGGGGAACA
ACAAGTTTTCCCAGCACATGAAAAATAACAACGCGGCGAGCAACTTCAGCCTGAGCAAGAGCTTGCGCGAACAACGCGAG
TTCCTGCCGGCGTTTGCCGTGAGAGAGGACCTGATGCGCGTCATTCGCGACAACCAGGTCATCATTGTCGTTGGCGAGAC
GGGATCGGGAAAAACCACGCAGCTGACCCAGTTTCTATATGAAGACGGATATGGAAACGTGGGCATGATCGGCTGCACGC
AGCCGCGCCGAGTCGCGGCCATGAGCGTGGCCAAGCGCGTGAGCGAGGAGATGGAGGTGCAGCTCGGAAGCGTTGTCGGC
TATGCCATTCGGTTTGAGGACTGCACAAGCAAGCAGACCTTGATCAAGTACATGACCGACGGCGTGCTGCTGCGCGAGTC
TCTTAACGAGCCCGACCTGGACCGCTACTCTTGTGTGATCATGGACGAAGCCCACGAGCGGGCATTGAACACGGATGTCC
TGATGGGCCTTTTCAAAAAGATACTGCAGCGCCGGCGCGACCTGAAGCTGATTGTCACCTCGGCGACGATGAACTCGAAG
CGATTTTCGGACTTTTTCGGCGGCGCGCCCGAATTCATCATCCCAGGCCGCACATTTCCCGTGGACGTCATGTTCCACCG
ATCACCCGTCGAGGACTATGTGGACCAGGCTGTGCAGCAGGTGCTTGCCATCCATGTGTCGATGGGTGCGGGTGATATTC
TCGTCTTCATGACCGGCCAGGAGGACGTGGAAGTCACGTGCGATCTTGTCCGCGAACGACTGAATGCCCCTACAAAGACC
CGCCCAAGCTGAGCATACTGCCAATGTACAGCCAGATGCCGGCTGATCTCCAGGCCAAGATCTTTGACAAGGCGGAAACA
GGCGTGCGCAAGTGTATTGTAGCTACCAACATTGCCGAGACGAGCTTGACGGTGGATGGTATCATGTATGTGGTTGATGC
GGGCTATTCGAAACTCAAGGTGTACAATCCGCGCATGGGCATGGACACGCTGCAGATCACGCCGATCTCGCAGGCAAACG
CATCGCAGCGTTCGGGTCGCGCTGGGCGCACCGGTCCAGGCAAAGCATTCCGCTTGTTTACCGAGAAGGCCTTCAAGGAC
GAGCTGTATATCCAGTCGATTCCCGAGATCCAGCGCACAAACCTCAGCAACACAATCTTGCTGATCAAGTCTCTGGGCGT
CAAGGATCTGCTGGACTTCGACTTTATGGACCCGCCACCACAGGACACCATCACGACATCGCTATTCGACCTGTGGGCCC
TCGGCGCCCTGGACAACTTGGGCGAACTGACGGATCTGGGCCGCAAGATGAATGCTTTCCCCATGGACCCGCCACTAGCC
AAGCTGCTGATCATGTCTGAAGAATACGGTTGCAGCGAGGAGATGGTTACAATCGTGTCGATGCTGTCGGTGCCCAATGT
TTTTTACCGGCCCAAGGAGCGGCAAGAGGAGTCGGATGCGGCGCGGGAGAAGTTTTTCGTTCCCGAGTCCGACCACCTGA
CCTACCTGCACGTGTATTCGCAGTGGAAGGCCAACGGCTATCTGGACGGCTGGTGCACGCGGCACTTCCTGCACTCCAAA
TCGCTGCGGCGAGCAAAAGAGGTGCGCGAACAGCTGGTGGACATTATGAAGCTGCAGAAGATGGCGATGAGCAGCTGTGG
CTCAGACTGGGATGTGATCCGCAAGTGTATCTGCTCGGGCTACTACCACCAGGCGGCCAAGGTGAAGGGCATCGGCGAGT
ACATCAACCTGCGGACGAGTGTGACGGTGCAGCTGCACCCAACCAGTGCGCTTTACGGTCTGGGATTTCTGCCCGATTAT
GTCATCTACCACGAGCTCATCCTGACGTCCAAGGAGTATATGTCGACTGTGACGGCCGTGGACCCGCGGTGGCTGGCAGA
GCTGGGCGGCGTGTTCTACTCCGTCAAGGAGAAGGGCTACTCGGCACGCGAGAAGCGCATCGTGGAGACCGAGTTCAACC
GAAAGATGGAGATCGAGTCGAAGATGGCCGAAGACAAGAAACGCCAGGAGGCGCAACAGCAGGCCGAAGAGGACAGAGCC
CGCCGGACGAGTTCGGCTGTTGCACCCAAAATCGGCGACACAAGCAAGAAGATCGTCGTCCACGGCGCCGTACGGAAGCC
TGTGGCGAGAAAGCGTGGACGTGGATTTTGAGACTTGTCTGTGCTCGTCCTCTGGCTATGTACACCTCCGGATGACAAAG
TCTGTCTCGTCTGACCGGAGCTCCCGGTCCTCCTTGTCGAGACGCACGACATGCGCGTGACTGGGACCTCGGTCGATGAG
TTGCATAAAGGCCGCGATGCTCTTCTCTTCGCCCTGAACCTCGCCTTCGACCTAGATAAAGTCCGCCAGTCACTCGTTAG
ACTGTGCAGCACTGTCGTCATCGACACGACTTACCTTGTTATTGGGGAGATTCTGCACCCAGCCAACGAGCTCATGTTGG
ACAGCATGCTTCCTGGCGAAATATCTGGTCACCGGTCAGCATGATGAGAAGCTCATGTGGCCACGTCAACTCAAGCACGT
ACCGGAAGCCAACGCCTTATCCGGCAGTTCAGATTAGCATTTTTAAACACACCTAACCAGTCCTCTCCCAAACACACACA
CATCTCACCTTGTACCCTGCCGCCATGCACCAAATAATACACCTTTTGGGTTAGTGAACGAATCACTGAAGCCGGTTCGA
AGAATTATCTCCATACTCGTTTTGCAGCCATAAGTTCTGGCTCGAGCCTACAGGCCTTTAATGTTGTTATAATAGAAATG
TAATGCTCGGTATATAAACTTGTATGTTTTTTGCAGAACGTTTACTGCAAGACAACGAAGCCACACGCATCTTCTGTCGA
TTATCTGGAAAACGGATCATAGATGCAGCCAGTAAATTCCGACCGAAGCCTCATCACGTGCTCTATCACGTGTCGTATAA
TATGATGTCAACGCGACCTGATACAATTTCAGCGGTCGATCAGAAGGCTGACACCTGCCTGCCAATATCTTTCGATCAAC
ACATATTCAAAGCTACGCTCTCGTTTCCTACCACATTTGCCTGTTGCTTTCTGGTGTTTGAGCACGCCTCACAAAACTAA
GGCCGACGTGAGAATGGAATCCACCAGCACAGAGACGGGCGCAGTTCCAACAGTGCTCTTTGGCCGGCCTGGAAAGAAGC
GGAAGGTTTACCGACAACGGCACGAAACTGAAGGCGGTCCTGAAACGAAGATTGACGGCCATGCTGTCACTCTATTGCCA
CGGCCCGTTTCTATCAGCGACAACGCGGCAAAGGACGACACCTCCGGGTCAGACGGTCAACGACCTGCAGAGACAACAGA
GGATGCCCGTGCCGACATCGAGATCGAGAACGGCGACCGTGATGGCGATGACAATAGGGACAGCGATGAGAGCGAAGTCG
ATGCTGACGAGCTCGCTTCGATAACATTAGCAGAGTTGATGCGGCTGCGAAAGGGGCGCCGACCAAAAATGGGCGGAGTT
GAGTTTCGAGGCGACGAAGGCGGTCCGTCTTCTTTGTTGCAAAACATGGGCAATCGGCTGGGAGACTTCAATTTTGACAA
CCTCGATATGAGCTTGGATATGTCTGTGCCGATGGACATCGGCTTACGATTTGCGCCCCAGACGGGGCTCATCGGCGATG
TTGTGAACAAGCATATGTAAGTGGCAACATCATACCTCCACGTGTTCTCTACCCTATCTTTTTTCCCGCCCGGTGCATTG
AAGGCTGAAGCTAATCCTGCAGGGAGGAATACGTAGAAGCTGAAATGGCCAAGCGATATAATACAGACTCGTCACAGGCG
GGAGGTGGCCATAGCGGTCGGAACGGTGTTTCAGACGGCATGGGAGCTGGCTCGTCAAGCCTGAACAGCAAGGAAGTGCG
CGAGCAGCTCGCTATGAAAGGCAAGCTTCATGAGATCGACCTCGGCGCTGAGTCGCGCGCCCGAAACGTCGCCATGACAG
AACGGGCTACCCGTCGGCTGCGAGGCAACGACAATGTCGTTGATGACGAAGCCGGCAAAGACGAAGACGTCCAAAAGCCC
CGAACAGGCAAAAAGGCTCCTGGCCGCAACGGAAATCCGCCGCCGCGGGATCGCCGCAATAGCGACGACATCAAACGAGA
CCAGATGGTCGAACAGTTTCTGCATGAAAACAAAAGTATGTGTCCTTGGTGCCCGCGGTCGCCCATCGATGAAAACTTGC
TGCATCTGCTAACCCTCGTCTAGTGGATGTGGATGTGTACGATGTTGCCCGCGATACGGCTACGGGGGAGGGACGTCCAG
CCGACGACCGCGTTGCTGAGCAGTTCCGCCGGGAGTTCATGGAAGCTCTCGCCCAGCGGCTGCGACGAAAGCGCCGGCCT
CTGGGACCTCCGGCGAAACCAAAGGTGCGCAACGAAGAAGAGATTCTCCGAGGCCCCAAGCTAGGTGGCAGCCGCAACGT
ACGGTCGATCATGCGCGACAAGTTGCTGCAAAAGCAAGAGGAGGAACGGCAAAACATGCCAAAATACGAACAGGAGCTGC
AGGAACAGCGGCGTCGTGCAATGCGCCGACGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62