GenePrediction:GLEAN_598 Details

Name: GLEAN_598
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:848648..855115 (+ strand)
Length: 6468
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:848648..848741 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_97:849087..850003 (+ strand)
Length: 917
Type: CDS
Source: GLEAN
Position: GCSC_97:850088..850641 (+ strand)
Length: 554
Type: CDS
Source: GLEAN
Position: GCSC_97:851431..855115 (+ strand)
Length: 3685
>GLEAN_598 class=GenePrediction position=GCSC_97:848648..855115 (+ strand)
ATGAGTCAGCAAGTTGGCCTGACAACGAGGCACAGGCCAGCCAGCCTTCCCCTGGCCACTAGTGCCAACCCCACCGCTAC
TGCACTGAAGCCAGGTGCGGATGACGTTCGTGGCTACCCCGCCAGCGTTTGTCACGCGGAAGACAGGCAGCGACTACAGC
GACCTTTCTGCCTGATACGCTGTAGTGAGCCTGACCACACACACCTCCTGTCTTTCTTGACAAGGCTATTCACCAGCCTT
TTACGATGGGCGGTTGACAATCCGACTCCCTCCGCATCTACTTCGTCCCTCTTCGCATCCAGCAACATGTCTCTATTTAC
GGCACAGCTCCATCCCGGGCGAGCGCTTGGGTTTCTTGGTGAGAACCCCTATTGGCAAAGACGGCCGTGTGTTTGTATGT
GTGGAGGGCTGACCGGCGCGGTGTTTCGCGTCTTTGCAGCACTGGGCGCCTCGCTCCATGACGTGCTGACGCGTCTCAAG
GCGGAGCCGCAGCGATTTCCCAAGCTGGACCTGGCGTACTCGGCGACAAATCCGGTGAGCGAGCCGGTGGTGCTAGGACT
GCCGGCCAACGGGATCCGACTGCGGTTTGACGGGCCAGAGCAGCGGCTACGACTGATCGAGATCCTCGACTTTGGCAAGA
ACCACATCGTCTTCAAGGAGCACAACAAGGACCGCGACCTGGTCAAGCCGGCGGGCGATCCGTCGGCGTCGACGGGCGGC
CCGACCTTTCGACACATCTACTCACGCTTCCTGGGGCCGACATACGACGGCGAATACGTCCGAGGGGCGACGGACGGCGA
GGGCACGTACGTGCTGTCATACCCGGGCGTGGCGTTTACGTTTCCGATGGCGGCGGCGGCCTACGCGCCCGACAAGGACG
TGGTGTCGCTGCTGTCGACGCCGACGAGCCTGGCGGCCGTCTCGATGGCCGTCTTCAGCGGCGACTCGTGGGCCCAGGCG
CGCGAGCACCTCTGGACCGAGGTGCTGCCGCCCATCAAGACGTTTGCTCCGCTGGCCAAGGGCAAGGACAAGGACGCGGC
GCCCGACGAGATCTCGCTGGTGCGCGTGCACGGCGGCGGGCGACTGCAGCTCTTCCGGCGCTGGGCGACGACGGCGAGCA
GCGCGTTCGGCATCGCCCTAGGCGAGACCACACCGCAGGAGCTGGTGGCCGAGCTAGGGCCACCCGACGCCATCTACCGC
AAGAGCGACCAGCGGATGTACATCCACAAGATCCGCACGGCCAGCAGCAGCCGGACGCGTGGTGGTGTGGGTGGCGGCCT
CGCTGGTGGCCATGTTGGCAGCCATGGCGGCAGAGCTGGGACCGACGACCACCTGACGGACACGGACCAGTCGTCGGTGC
CGGCAGCATCGGACGAGGACGACGAGGACGAGGACGACGAGGCGATCGAGGACGAGTTTGTCGGCAACGTGTCGGGCGAG
TGCTTCTTCAATTACTTCTACCTCGGCTTTGACGTGCTGGTGTCGACGCCGGGACCATCGTCACGGATGCCGCCATCGCA
GGCAGCGGCATCAGGGGCAGGAGACACGGGCACGGAGTGGACAGATGCGAGCAATGGCGAGGGACAGCGGCCGCTGAGAA
CGGCCATGGCCGACCGGCTGGTGGCGACCAAGATGGTGCTCCACGGCAACGTGCCAGGGTCGTACCCGTTCAACCGACAC
CGGCGCTGTCGGTGGGAGATTGCGTACATTGAGGCGCGGGCACGGGCAGACTCGGAGACGCCGTTTCCGCAGATGGAGGC
AGCGCTACACGAGGAGTGGAAGACGATCTACGGGTCGGACGAGGAGGCGCGGCAGCGGGAACGCGGCATGGTGTTGAACC
GGGGCTGGGGCGACAGTCCGGGCAGCAGCATCGAGCTTCTGGGCGGCTGGGAGGGCCACAGTGGAGGGGCAATGCGCGGC
GTCAAGAGCGCGGAAGACTCGACGACGACGCTGTATGGCTTTCCAGGGCTGGTATTTGAGGTGCTTCGGAACGGGTTTGT
GGGAGCGCTGACGGTATTTTAGGGATGAGGTGTTGGGTGTATGGGAGGTGAGATGTATTGGTGAAATGGGAAGGGTGTGC
CTGGACGAAATAAAGGTAGACGGAAGATTACATGCATCGGAGCGAGGCGTTTGGCAGATAGAACCTATCCATACGGAGTA
ATACCCGTACTGCAATCTCGCTTGTCAGCACGTGTAGAGCCGCCTGCACAACAGGCTCCAGGCCTCTGGCCAGGCAGGCC
CCGCAGTTCCGTACTTATGTACAGCGGGCCCCATCCTCTGCTAGTGCCGCTGGGCCTTGCACCTGCAGGCGGCCTCACCG
CAAAGGGCCCCTGGTGGATCTGGGCCTGTCCGATCGCCCAGACGTCCCCGTTTCCCTGCTTCCTATTACCAGGATAGCCA
ATTTGCGATACGTCCACAGCAACCCCATTTCGCTCTCGGTCCGGGCCCATCTTGGGACAAGAGGACACAGCTTCGTGCCC
CATTCTACGAGTACGGAGTACGGAGTACGCAGGCCTCATCGCGTCTGCCTGCAGCTCGTCCTCGCCATCGTCAAAGGCCG
AATACGGCAGAAGAGACAGCCTACACCAGAACGAGGTCCAGCCCACCAGCCCTGCAACCTTTCCCTGCATCGCCGCTGCG
TCTCCTCGACGATGCCTCGCGTTCGATAACCGCTGGTCCTCTTGCTCTCGCTCCCGGGTCATGTCCTCGATCGTGCCTCT
CTCGTTTCCCGCCTCATTCTCACCTGCGCTCCGCATGGCCGACTCGTTCTCTGTCGAAGCTAGCCGTCGAGGCCCGGCCT
CCCGGGGTCGGTCCGGCCTTGCGCGATCGGCCAGCAGCGGCACCAGCACCAGCTACCAGGCAGCGTCTTCTTCCACAACG
CCACCGGCCACGGCCACCGGTACTCCGGCCAGCAACGACTCGCCCGGGCCCACGGCCAGCATCTCGACTGTCTCGACTGC
ATCGACTGCCCCTCACGATGGGCCATCGCCCCAGCGAAGCGGCACCCATCGCTCGTCCCATCACCGGCCGCACGCCCACC
AGCGGCCTGGTGCCGGCGGCTTCTTGCTGCAGGGCCCTCTCGATGGCCCAGCAGCAAGAAGCCGTCGGGACAAGGCCGCC
AACAGGACGGCCGACAGCATGGCATCACTGCCCAGCGCTGAGCATGCTGCCTCGCCCGATCTCGACGCGGCCCAGATCGT
CAACATGGCCCTGAACCTCCGCGAATCCCGTCGGCTGCCGGCACGGCGATCCGTCTCCTCGTACCAGGTCCCCCCCCGGT
TGGCTCCGCTGCCGGACAGCAGCGTTGGCGGCAGCCTTCGACACCAGCTGCAGCAGCAGCGCCGCGTATCGCGCAATCTG
TCACCGCGGCCGGACCGCGATTCAATCCCGGCTATCTCTGTCTCGGCCTCGGCCGAGAACCAGACCCCCTTTGACACCTT
CCAGGAGACTTCGTATCGATACCATCCCTCTCAGTCGACGCTGGCTCGGGCACAAAAGGCCCGCAACCATCTCGAACTCC
TGGCCCAGCACCGACGGCTGCTGGCACTCCTCCCACCACTGACACCACCTCCACCGGCCTCGTCGGGTCAAGGCAGCAGC
GGCAGCAATACCAATAACACCAACAACACCAACAGCAACAACAACAACAACAACAACAACAACAACAACAACAACAACAA
CAACAACAACAACAACAACAACAACAACAGCAACAGCAACAATAACAGCAACAGCAACAATAACAATTACCGACCATACA
ATCCACTGCAGTACATCCGCAACCGCAAGGTCCGGGCGCGGGAACGCAAGGCCATCAACGGTCAGGCCCAGGGCTTCGGC
TACGTGCTCAAGACGACGCAGTGGGTCGACGAAGTCGAGCGACAGGCAGGTCGAGCGGCTGACGAGGGACGCTCGCCTGA
CGGCGGCATGTTGCTGCCCCCGTTTGCTAGCGCCGACGAGGCTGCTCAGCACAGCTCGTCCGGACCGGCATCGCGCATGA
ACACGGCAGCCGGCACGCGGGCCAAGCCCAAGCGGCCACCGGTCGACTGGATCATCGACCCGGCAGACATGATTGCAGAC
GTGTACTGGCTAGAGCAGGACGACAACAAGCGTCTGGTCGAAGACCGGCACTGGCACCGCGTCTTCCCGCAGGACGACGA
CACGTACAGGCCGCTGTCGGGTCGCACAGACGAGTCGAGCCTCGGAGTAGACCTGCCGGAAAAGATGGACCTGGCCCTCG
ACGAGGCCGACATGCACGGCGGACCACCGGGAGCGAAACCGGGGGTGCCGTTGTTGCCGTCGCCTTCACACGAGCCAGAG
GTCGGATCGGCACGCGAGCGAGCACGGCAGAAGCTGCGCGAGCTCAAGGGGCTGCACCAGCGCCACAACAACTCGGTGCA
CGGCGACCTGTTCCTGGCCCAGCACGGCAGCTCGTTTACGGAATCGTCAGACTCGGAGAGTGATCGACGCAGACAGGCCA
ACCGGCTGCGGTCCGACACGGTCACGGCTACGGGGGCTGAGATGCTGCGGCGCCAGATGGTCGACCGACTGGCACAGGAG
CAGCGCGAGCGAGACGAGGGATCGAGCTCACTCTCGCCGCTGCCCAGCCACAGCAGACGGGCATCGGAGGTCGACATGGC
CGCGGCGACAGGGCGGGCGAGCCTGGAGGTACCAGGTGGCGGGCGGCCACTGTTGGTCGACTACGACTCGTCGCAACCAG
CATCGCCAGAGATGCGGCCCATCTCACGAGAAGGACTGGGCTTTGTACCGGCACTGGGCGGCGATCTGTCGCCGGTACCA
AGCCGCACGGCCTCGCCACCACGTCACCGGTTCAGCAAGGTTCGAAGCATGTTCCGAGACCACAGCCGGGAGCATGGCGG
AGGAATGGAGGAGACAGTGCGGGAGGAAGAGAGCGAGACGACGATGCTGGGGCCTAACGACGCGGCGGGCGAGACGTCAG
AGACGCCACTGGCCGATCTGACACCGACGACGACAGCGGAAGCGGTGCCGACGATCGAGCTGAGTCCGACAGGGCTACGG
GCGTTTCTGCGAGGCGGTCCTCGGATCGATGCGGTGATCCGGAACGGCATGTCCAAGATGAGCGGCATGCTGTGGCGGCG
TGAAGCAGCCGACACGACAGCCGAAGGACTGTCGTCGTGCACATCGTCATCGGACGAGGAGAGCGACGCCGAGGCCGAGG
CGCTGTCGCGAGGCCGGTCACGAAGCAAGGCCGGTAGCCGGCTGCTATCACGGTCACCATCGCAAGCAGGCATGGGAGCA
GACGGAGCGGGTGCCGAGAAGGAGAAGCCGGGGACGAAACACTACCTCGACATCATGCCGCGATTTGCGCGGAGCGAGAG
CAGCACGAGCATCGCAGGCGGAGGCGACCAGGGACATCAGCTGCTGCAGGTGCCCAGCGCTTCGACGGCCGATGCGATCT
CGCGGCCGGCCAGTCAGCAGTCGGCGCGCTTTGAGCGGCTCAAACCACCACGGATCGACATCCAGGCGGCATCGCCATCG
GACAGCGTGGCTGACCAGCTGCAGCTGCTGGGGATGGACGAGCAGCAGGGCTGGCACGAGTCGGACCAGTCGGAGAGCGA
GTCGCGGTCACGGCCAGATGGTGGTGTGGGTGTGGGTGAATGGTCGGAGACGCAGACACGGCAGCGGGCGGTGTCGTCCA
GCGGGCGCTCGCCACTCTGTCGGCGGGAGCTGGCACGGGTGCGGGCCTCGCTGCTGAGCTCAGCCGTGGTGGCCAACGAG
CTGTCGCGGCGGGCGAAGCAGCGACGGGTCCTGACCGAAGATGGATGCGCGGTGAAGACGATGGAGGGGAGTCAGCAGGC
AGATGAGGCGATTAGTCAGCAGACGAAAGACGAGGACGAAAGCAGCAGCAGCAGCAGGCAGCCGAAAACGCCCTCGAGCA
TCGTGGTCGCGCGAGGCAGCGACGGGACCGTGCTGACATGGGCGGACGTGGCGGCGTTTGGATGTTCGGAGGCGGCAGCG
ACAGAGCTGGCGCGACGGCCGGTGGCGCCGATGGAGCTGTACCCGCTGGCGGCGCAGGTGATGGGAGCGGCCGTGCAGCG
AAGCGGACAGGCGTGGCAGGAGACAGCTGAAGTGTTTGGAGGGACGCGAGCAGAGGCGCTGCGACGACGGGCGGACGAGC
TGCGGACGCGGGTAGCGATCGGGCTGTCGGGGCTGGCGTCGCAGGCAGCCGACGAGGCGGACGAGGTCAGCCGCGAGCTC
GCCGACGTCCGACGTCTGCAGGTCAAGCGGCTCGACGACGCCATCGATGCGATGCTGCGGCGACGGCGGCGACGGTTCCG
ATGGGTTCGGCGGGCCGGCTGGCTGACGGTCGAGTGGGTCCTCGTCGGCTTCATGTGGTACGTCTGGTTCGTCGTCATGC
TGGCACGGGTCGTGCTGGGGGCGTTCCGGGGGGTCGCCGTCGGGATCCGATGGCTGTTGTGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62