GenePrediction:GLEAN_5990 Details

Name: GLEAN_5990
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:681466..679204 (- strand)
Length: 2263
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:681466..681226 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_82:681128..680592 (- strand)
Length: 537
Type: CDS
Source: GLEAN
Position: GCSC_82:680159..680075 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_82:679985..679913 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_82:679810..679704 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_82:679609..679362 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_82:679301..679204 (- strand)
Length: 98
>GLEAN_5990 class=GenePrediction position=GCSC_82:681466..679204 (- strand)
ATGGAGCTCGGCGCTGCAACACAGCTGTTTGCAGCACCGGATGGGCGCAGCACGAGTGGGAAACAGACGGGCTGCAACAG
GGTCTCCACGGACAGACAGCCGTGCTACTATGTACTGTGCCGTATCGTGACGGTTTGCAATCCAGACAGGTGGAAGGTAG
CAGCCCCTGCACGATCTGACATGCATATAATACCAATAATGCCGGCAAAACGACCGGCCGCTCAGACAGTCCAGGAAGGC
AGTCAGTGAGGTCAAAAGGCAACAATACGAGTACGAGTATCTTGCACACAGAGTAGTAGCAGCACGCCATCGTGTCCCTT
GCGTCTTCTGCTCAACAGACCCCGACCCCTGGAGCAAGACAAAACATGGGCCCGCATCTCCATACATAGTATCACAAGAC
ACCCCCTTGTCGGTGGTGGTGGCCACGCAAAGACGCAAAGCAGGCACACAGGCTGGGAAAGGCCGCATATGCCAGCGGTT
CGTGCAAGCAGCGGCCAGATCGTCTGCGGCCTTTCCCCCCACCAACAGGCCTGGTCAGGAGCGAGCGGAAGCACGTAGAA
GGGGGCCAGCAGGCCTTGCTGGTCGAAACGTCCTCTGGCTTGCTAGCCTCAGCAGCGTGTCATCAAGAAGGGGTCTGGGG
CAAGAGGACTCCGGCAACAGGGATCTCCTGCTGGTAGCTCCCTCCCGTTATCGGGATCAACCCGTCTTCTTTCTGCTCGA
TTTGCTCGATGGGCCATCAGTCATGGAGGCTCGCCTGCACCATACGTACGCCCCGTTGGTGGGAAGTGCGAAATTGGGAA
ATCGCGTCGCCGTTGGCAGGCCGAACCAGGCCGAGCCCCTGCACTGTATTTCACCCCTCCTCCAGACCGATCGACGTATG
AGATACTTAACAACCTCTTCTTCACCCCGCCCCGGCCGTTCCTTGCTGCCTACCATCGACCCCCGTTCTGTTCTTCTGCT
CTCTGCTCCCATTTTCTTTGACCTGGTCGCGCTGATATACTTTCACCATTTTCCCAAGACGCAACGCAGCCAGTTGTTCG
CATCAAATATCTGCAAATATCTGCTCGTCCTACGTCCTCTCCTCTTCTGCCCTACTTTGCTAACCGGCTGAATTGTCCGA
AACGCACAAAGTATTTTATTTGTCTTCTGCTCAACCGTCGCTCCATTTTCCGTCGGCTGAGCCGTGTCTGTCCTTGCCAA
CCGCAACTTTGCCATTAGGCTGACATTTGCCCCATCCTTTTTCCCTTTTTGTCCTTTCACACATCATTGTTCGAGTTGAG
TCGAACTCGCGCAACTCGCTCTTTCAGCCACCCGACCGCCTACCTTTGCAACCTTTACGACTACAGTTGTCCTTGACATT
CCCTTCTCCAATATGGCGAAACTATTTATCGGGTAAGCCGTCCCAGCGCCTTTGCCCTCACTTCACACCTCACCTCGTCC
TCACACTGCCGACAGACTGCTGACACGCGGCCTTTCTGCAGAGGCCTTGCCTGGCACACAGAGGAAGGCACCCTGCGACA
GAAGTTCGAGGAGTTCGGTCCGGTGGAAGAAGCTGTATGTCCAAATAAACCCCTCTAGCCAGGCCTCTGGCGTGCCAACT
CGGCAAGGTTTCACGTTGTCCAGTCTTCTAACCCTGTTCCGCCATCTTTGCTATAGGTAGTTGTGAAAGACCGGGACACT
GGTCGCAGCCGAGGGTTCGGCTTTGTCCGCTACGCGAATGAGGCCGATGCCGAGACAGCGATTGCGTCGATGAACAACAT
TGAGTGAGAGAGACAGGACCCTCCTCCCATAGCCTGATGCTTGTCCCTTGCAGAAGACCGATAGCCCTGACACGCGTGCC
GCTTCTGCGCTTTCTAGATTCGATGGACGAACGATTCGGGTCGACCGGGCCTCTGACAGCGGCTCAAGGGGCGGCTTTTC
GGGACGTGGCGGCGGCGGCGGCTATGCTCCCAGAGGTGGCTACGGAGGCGGACAGCAGATGCACCAGGCACCCTATGGAG
CTGCGCCGCAAGGGTACCAGATGGGTGGCCCGCCAGTGTACCAGCAGTACGGCCGAGGCGGCTACCCCCCACAGGTTCCT
CAATACGGCGGGCAGCCTAATCAGGGTATGACTTCTCGTACCGACTGAGGCTTCAGGACAAATGCACGGGACTGACATTT
AGTAGGATGGGGACAACCCGTGTATGGGTACCCCGATCAGCAGCAGTCTCCGCCCCAGCAGCAGGGACAGCAGCAGCCTC
CCCAAGGTGGCCAGGGCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62