GenePrediction:GLEAN_5992 Details

Name: GLEAN_5992
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:671219..667925 (- strand)
Length: 3295
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:671219..671106 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_82:670988..670596 (- strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_82:670525..670070 (- strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_82:670014..669703 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_82:668197..667925 (- strand)
Length: 273
>GLEAN_5992 class=GenePrediction position=GCSC_82:671219..667925 (- strand)
ATGCCGCCCAGATCATCCCTCACCTCTTCCTTTTCCATCACCGACGCCAACAATGAAGTTGTCTGCCCCTTGAGAAACCA
AGATGGCTCCAGCTGTCGGAAGCGTTGCATCGGAGTAAGTGGCCCCTCTTCGTCCCTTGAATTTCACAGTGCATGCGCCC
TCGAATCAGAAGAGGAAGATTGTGGATATATTGTGGTTCAGTGGATGCTAACGGGGCTGCCAACCGATTAGGAGAAACGG
TATCGCTCCATGCAGGAGCATATCCGACGTGCCCACCCAGAGCATTACATATCTAAGCTCCCAGCCACCGAGGAAAGCTT
CATGCTTATGATCAACACCCCGCCTAGTGAACGGCCACAGAGCCAGCACAACTCTGGTGCTGGTCCGCCCGGATTGTCTA
GCAGCCCTCCCGGAGGCCCCACTGCTAATATCGTCAACGGGTCGTCCATCCACCAGAACAAGCCGTACCACCAAGAGAAT
GGTGCACTGAAGCCAAATGCGCAAGGCGTTCCCCGGAATCCCGATAACGAATATCCGCTCGGGTCCATGCTGCACGCGGC
AAGTGCTGCCGCCACATTGGCACAGCTGCACAATCACAAACTGGCGGAGCGCGATTGGGACGATGTGAGCCTGACCTTTG
CAGCTTCTATTTGTTGCTGCCCAAGAGTCTGTTTGCTAACGCAGCACCGCTCAGGGCTGGCACTCTGATAATGAAAAGGG
TAGAATGTCCCGAGCATCCATCGAATTGCCCCCAATACACATGGCCAATCCAGATGTAACAAGCGAGCCTTTTCCTGGCA
TGAACCACAACCGTCCGCGCGAGCTTCTACCCTCAATATTATCGACATCTCCTCCTGGGCGATCGTCCACGCTGCCTCCA
CTGCAGCGTCCGATGGGACCCGCACGGCCGAGGAAGCAGTCTGTCTCCAAGCGCTCTCGCGAGGCACATCACAAGAAGCA
AAGGTCACGAGGATCTGGCTCCGATTGGTTGCGCAGAATACAAAACGAGGCTTCAGCTCTCGACCGCCTACGCCCGGGTG
GTCCCATCAAGGCCATGTCGGCCGAGCCGTCGGAGTTTGGCAAGCGTTGGGAAGATCTCATCGATGCTGCTGCTTCGGCT
ACGGAAGACATTGACGAAGACAGAACGCCTGTAAGCTGTGACGTGGTTTCTGCTATCTGTGCAGACTACTAACTAACGAT
GCAAGGTGCCACAGTCGCCCATTTCCATACATCGTGCTTCTCTGCCACCCTTTCCTCATCACACTTTCCAGCATCAGCAG
ACCCATGGCTACCAGGCGTCGCCGTTGCAGCAGGCCCTTACGCCCCCGTCATACGCCCAGGAGGCGCCTGAACCGTTCCC
GTCTGTGGAGAGCAACGAGAGTGGCGATGTATTCAACATGGATTCGCGCGGCTTGTCTGACTCATCCCCGAACTACTCGT
CCCAGAACCCACAGATATACTGCGCCGCCTGCGGTGGTATCGCACAGCTCAAAGAGTCGTACGCTTGCACGGAGTGCGTA
TGTGGTCTTTGTCAAACCTGCGTGGGAATCCTGATGGGCGAGCAAGGTGCCCGAAGGAAATGCCCTCGTTGTCATACCAT
TGGCGGCCGTTTCAAGCCTTTCCAGCTTGACATTAGATGATGTGGTATACTCGTCTGATATTCCACCAGCCCTTTTTCCT
TTAGTTCTCTCAGCATTACGGGGGCTCTCCCTCTTTTTTTGGTTGTTTCACGTTATATCGGTAGAGCATTGGCACGCTAG
ATGCGGCCGCATTACCATGACATCTTTACTGAAGTCACTACAAGGGCGTTACAGAGGGTAGACCAAGATTTGATCAAGCG
ACACTGGCACCACCGAACTGCCCATTTTGTTTTTTTACTGGGAAGATTTTTCTTGGCTTGTTTTGGGGGCTTTTTTTCAT
TGCTGTTTGTTTTGGACGTCAAGAGTTGACAAGCAGTTTGCTTGTCGAGAACCACAAGGGCATATTTCACCGTTTGGACG
GTTTTCCTTGTTCCCTCTTTACTCGGGCTTATTCTGGGGCGTTGGGTATCATGACATCAGAGGGCGTTGCTTTGACACTA
GAACACTACCGACGTCGCCACACGATCGTTTATGACTCTGGCCAACTTATGAGAGAAATGGCTTAGGGATGGAGTTTTTG
TCAATATCAATCAATGTATTATGGCTTTAGGATAAGCTTTTAGGATCAGCCCCCAATCTTGTCTAGGAGTGAAGCCTCTT
TATCGGGACACTCATTTTGTCAACGGATTAGTTAGTTGGTTACGTTTTTCATGCTCACTTATCTCAGCGTTCAGAGAATT
CAGCTGCATTTTAGTAGTATCGTATCTTACAAACGTGATTGTGCTAAAGCTGTCTACTTCTAGCCTGACTGACTCCGGCG
CTGGCTGGATTACTGGGCAGTGACTGCCCTTTTACATCTTGATGGGGACGAGCAAGGACTATAGACATAGCAGTGCCCTT
ATTTCCCATAGACATTATGATGAATGTAGTGCAAAGACCGCGCAGGTGTTCCGAATAGCCCTCCTGTTCTCAAAGTAAAA
CCAAAAGCGTGAAACATAGAAGCATGCAATGTTTGGGAGGGGGTTCGATGTCTTTACGACCTGCTTTTGAGCAGAAGTCG
ACTCGCCAGAACGCGAATTGGCAAGTGACCTAAAGACAAGGAGCAGGTGCCTATGGCCTGTTGACGACGGCGCTTCACCG
GCCGATGAAGCGTCCGAAGACGCCGGTGGCGATGCTGCTGGCAATGTTGGTGGAGAAGGCTGAGCCAGCCATGTTGGAAG
CCTGGCCGAACTTGTCGCAGCGGGAAAAGGCGAGGGCGTTGGTGATGGTCAAGGCGAGGGCGATGGCTGCCGACTGTCAG
CACGAGCGAGAGAGCAGTGGGAGGAGAAGCAAAAAGAGAAGAAAGTCGGCTTACCAAGCAGCGGCAGCCACAGTATGTTA
AACCGGAAGATGGCGAGGATGCAGAGGCCGGACCACGACAGCGGCTGAACATAGAGGGCTAGCCAGAAGAAGCGGCTGTC
GGTGGCGTTGTTGACGCGGCCAGATGCCGGGTCGCTGCTCTCAAAGACCCAGTGGCTGTCGCCAGACTGCGGGTCAACCT
CATTCCACCAGCGAAGGCCGACGAGACGGCGGCCGGCAATGTTCTTGAGGTAGTAGAAGTCGGCAGCCAACAGGAGAATG
GTGATGATGAAGACGAGAACCCTAGGGATGCACTGTCAGAGGGGGGGAGTATAACCAAACCGGCAACCGGACGAGGTCAT
ACTTGTTGGCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62