GenePrediction:GLEAN_5994 Details

Name: GLEAN_5994
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:654927..650928 (- strand)
Length: 4000
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:654927..654507 (- strand)
Length: 421
Type: CDS
Source: GLEAN
Position: GCSC_82:654456..654299 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_82:654227..651360 (- strand)
Length: 2868
Type: CDS
Source: GLEAN
Position: GCSC_82:651122..650928 (- strand)
Length: 195
>GLEAN_5994 class=GenePrediction position=GCSC_82:654927..650928 (- strand)
ATGTCGCAGCTGTCTAGTTCGCATAAGGACTCGCTCACATCAGCACCATCTCCTCCGGCTGACAGATCAGTCTCCAGCGC
CACGTCTTCTTCGCTAAATGGCCTAAAGCAAGATACAGCTGCAGCGCCTCTGGAGCAGTTTCCGACGACTCCCGTTCCTT
CGCCACCTGCCCGGGCTGACTCTGCTCCGGCTGACTCTCGCTTCGACACGACTCCCCCGGACGGATCACCCATCTCCAGA
CCATACCGCCGAACGAGAAGCAGTTCAAGGCCCTTGTCGATGGTACAGACGTATCGCCCGTTCATGATGGAGATTAACGA
CACCATACCCGAATTGCAGCCTATCTTCTCATTCCTCAACAACCATGGCAACAAGCTGTACCAGGAGGGCTACTTCTTAA
AGCTGGACGACCAGAACACCCGTGCGTTCCCCTTCTTCTTCTGACTGGCAGCTCGAAACTGACCGTTTTAGATGGCCGGC
CAAATGTGGATAGGACCTGGACCGAGTGTTTTGCACAACTGGTCGGCACAGTATTGTCTTTGTGGGATGCTTCCGAGCTT
GACACGGCTGGTGACGATGGCGAAGTTCTGCCAAAGTTTATCAATTTGACTGACGCTTCGATAAAGATGGTATGTGCACC
AGCATGTGGGTTACTGCTGTGCTTAGTCCGGCACTACATGGAACTGACCTGTTCGCAAAGATTGAATCACTTCCCACGCG
GACCGCCGGCGATCAGCCGCTCCAGAACGTCCTCAGCGTGTCCACGGCTGGCCGGAACCGCTACTTGCTGCATTTCAACT
CACATCACTCCCTTATCCAATGGACAGCTAGCATCCGTCTCGCGATGTTCGAGCAGTCCACTCTACAGGAGGCTTACACA
GGTGCACTCATCGCTGGCAAGGGCAAAGCGGTCAACAACATCAACCTCATCATGGAACGGTCCCGTTTCAAGACAGAAGA
ATGGGTGCGTGTCCGCTTTGGTTCCGGCGTACCTTGGCGCCGGTGCTGGTGCGTCATCTCGCCGCCCAATGAGAAGGAGG
TGACGAAGCTGCAGAAGGACATAAAGAAGCGCTCTCCGTACGACCGGTCGCATACGCCACTGGTCAGGGGAGACATCAAA
TTCTACGACACCAGGAAAACCGGCAAGAAGCAGAAGAAGGCGAAGCCTATTGCCACTCTATCCGAAGCCTATTCTGCGTA
TGCTATTTACCCGCAGTCAAAAGCCCTGATCGATGCTTCTACTCTTGTCAAAATTGAGGGAAGCATAACCATCCACTCCA
ATCCGCCGTCCACCACAGAGGGTTTTGTCTTCATCATGCCCGAAGTGCACCCGGCCGTCACCGGCTTCGAGATGCTGCTG
CGCTTCCTCTTCCCTGCCTGGGATGCTTTCGGCCTCTACGGCCGTCCTGGCCGCCTTGTGGCCAGCGTTCTCGACCAGCG
GTCTCTAATGTTTGCCTTGCCCAAGCACAGACGATACGGCTACCTGGAAACTTCGGACGTCGCTAGCCTGCTCCTCACCG
AGGGAAGCTCGACATGGACAGAGCGAGAGTGGAGGAAGCGTATGAAGGAAGCCACTGGTCAGCACATGGCTGCTATGGAC
GAGGAATCCAGCAGCGGATTTAGCAGCCGCCGCACTTCGCATCGCAGCGCTTCGTACCGCAGCAACAGTCGATTCAGCTT
TGGGTTGGGCGGAAACAGCATCATGGGCAGTGACCGATCAGTCAGTGGGCGACTGAAAGTCAACTTCACTGGCGACAGAG
AATCCGACCGTTCTTCACGATCTATTGCTCCGGCTATCAGACCAGCTGTGCGAACCGATTCGGCCCCTCCTGCGTCTGAG
CGCCAGCCTCTTCCATCCTCCATGGCGCAAGCCGTTGCCATTGCTGCCGGACATGGCCGGAACCTTTCAGACACCAGACT
CAATGGACTGAACGGCACCCCGAGATCCAATCTGACCAATCCGCTGATAGGCAGTGCCTTTGGTGCCGCGTATCTCCCTT
CATCGTCCCCATCCCCCCCAACTCGGGGTTTTGTCAGCGACCTCTCCTCTACGCCGGAGCGTGTTAGCTCCGAGGATGAG
CTGCCAACGGATATGGACACCCCCCCTGCAAAGGATCTGCATGCCATGGCCCAGCGGATGGAGACCCCAGAGCCCGTGCA
CATGCCTCCTGCCTTCAGCCACTCGCCGTCCTCGGGACCGCCAACTACTATTTATCAGTCGGCTGAGCTCCGGAGGGCGA
ACAGCCGCCTGTCCCACACAACTCTTGCTCAAATTGCTAAAGCCGGTGGCGTTCTGCAGAACGGCTGGGCAGACGCCGAT
GGGCAGGAAAGGCAAACCACTGAAAGCGGCAGCTCTCGCAGCGAGCTGTCGGTGCCAGCGTTGACATATAAGCCGTCAGC
ATCTACGGACCCGTTAGGTTCACCCATCTCATCGTTGGACTCAACTGGCACAAATCAAGCGAAGTCTCCGTTGACTCCGA
CACAGAACAATCTCGTCCCTGCCCCCGATTTTCTGACAGATTATCTCTCGCAACCCACCAATGGATTCTCTGCGCTGCCG
CCCCTGCAAACCTCCCCTCGGGTTCTTAGGAAGCCTGTTCCGGCAGGGCTGGATTACCAGCCGCAGGACAATATCTCCGA
ACCCCATTCGGCGGCGACTAGTCTTGGAAGCATACCCTCGTACCTTATTAATGAGGCTGCCCTTGACCAGGTTCGATACA
ACGAGGAGGACAACGTGGAACAGCGCAACGTTTTCCGCCAGAACACAAAGAGAAGCGAAGCAAGCAGCCGATACGACGAT
GCCTCTTCGACGGCGAGCCCGGACTATGCTAGCACACTAGGATCGAACGAACCTCGAGAATCGGTGGAACGACCACGGGC
GGGTGTGCTGCGTACAGTTGGCGAAACCCATTCGTCAGAGTCTGGAGAGGAAACCTTCGACATTCCTGAAATCAACTTTG
GGCCGACCTTGAACTATGCTGCGCAGGCCTCCCAACGCAACATGACGCCTACCCCGTTCTCGGGCCCTTCAAGTCCCCCT
ACGACGATGCCCGCCCGGAAGCCCACTCGCGACAAGCTGCAATCTATGGAGTCGATCCACCGCCGGCAGGAGTCAGAGGA
GACAATCAAGCGGCGGAGTGTTGCCTGGCAACCTGCAGCGACGATCGCTGGAGGCTCCACTGGTAGTGGCGGTGAGGGTC
GGGCTGGTGCTTTGACTCCGGAACAGTTCGTGTTGCAACGCGCTGCCCAAGCTTCTATCAGTCCAATGTACTCCCATCAA
CGTGTTGCGTCCACCAACTCGGTTTCCGGCATCATCGCCAACAATACATCATCTCCCACACTGCACACCAGTTCAAGCTA
CGACATGCTCAACTCCGTGGCAGGCGCCCAGCTACAGCGGCCCAGCTCGCAGGGTGCAAACAGTGCTCTCGGTCTTGCCG
CCACACCCGATGTCGGCTCACATCTGTCCGCCCGGGAGCAGGAGTATCTGGCCCGCATGACCGGTGGCCCCTTGATCAAT
ATGGCAGGCAATCACCGGCCTCAGCCTAGCGACAGTGGTCCCGGTCTTGTAGCGGCTATTGCTGCCCGCGAGCGGGAGAA
AAAACAAATGAAGGAGGGTGTCAGCTCGCAAGCGGTGCAACATGCCATCAGCCAGCGACAGCAGATGCAGCAACAACAGC
AGTACATGCAGCAGCAGCAGCACTATCTGCAGCAACAACAGCAACAGCAACAGCTGCAACAGGAGCAACAGGTACAACAG
GCACAGATGTATGCAGGACAGCAGCCGATGTACAATGCATACCAGGCAAGGCCGCCTCTGGGCTCACACCAAAGCAGCTA
TGGCCAGGTGGCCGAACCAGGCTGGGCGCAGCCTCTTCCCGGCACTTGGCCAGCGATGCAGGGCCCTATGCAAGGCGCGC
AACAGGTACCGTACATGCGCGGCGGGAGTCCTCAGCAAGGACACCAATCCTACGGGCAATATCCCGGTCGTGCCTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62