GenePrediction:GLEAN_5995 Details

Name: GLEAN_5995
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:639848..635841 (- strand)
Length: 4008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:639848..639732 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_82:639675..637695 (- strand)
Length: 1981
Type: CDS
Source: GLEAN
Position: GCSC_82:637297..635937 (- strand)
Length: 1361
Type: CDS
Source: GLEAN
Position: GCSC_82:635870..635841 (- strand)
Length: 30
>GLEAN_5995 class=GenePrediction position=GCSC_82:639848..635841 (- strand)
ATGCAGCAGCGGCGCGATGAAATCCTGGCGAAGAAGGCGAAGCTCGCAGAGCTGAAGCGCCAGCGCGAGCTGCGCACGCA
GGCGTCTGCCAGCCGGCACAGCATAGGCCAGGCCGACGTGAGTGGAAGTGGCGGATGTGGATGAGAAGAGGAACGAGCTG
ACGAGGCGAGCAGCTCATATCGCCGGTGCCTGGACGGGCGGATAACCGGCGGGAGATTGAGTCGCTGATCAACAGCCTGG
TGGGCGAGAGCCGGCCGGGATCGACGACAACGGGCGGGGCGGCATCGCCGGCGCTCAGGGGCAGCCGGCCAAACAGCGTG
TTGAGTGCGGGTGAGATGAGCAACGCGACGTCCGAGTTTGCGCTGTCAGCAAACTTGCAGGCGGCAACGGGGCCGACGTC
ACAGCCGCAGGTGCTGACGACGGTGTCGCTGACGACGATCTACGAGTGTCCGCCGTCGCCGGTGAAGGAGATCTACTCGT
ACAGCAAGGGCGTGCAGACGACGGACGACCTGTTGCCGCCAGCACCTTTGCAGAACCAGGGAGCGTACGATTCGGACGGC
GACGATCCGCTGGCGATGACGACGGCGAGCAAGCGGATGAGCCGGCGGGGCCGGGACCGGGAAGAGGAGCTGCGCAAGAA
CATCCGGCGGGAGGTGGAGGAAGAGCTGCTGGCGACGCGGGAGCATCTTGCAGGCCAGGAAGACGCACGAGTCGAGGCAG
AGACGGCCAACTACCCGGCACGGGTGCTGACGACAGAGGAGCTGGAGGCGGTGACGTCGTCGGTGGATTTTGCGGACTTT
CTGGAACGGTCGACCAAGGTGATCGAGAAGGCGCTGGACCTGGAATACGACATCCTGACGGACTACACGCTGCAGGCATA
CGACAAGGACGAGGAGGACGAGCAGGGCAACGTGGGCGGCCGGGGACGGCGGAAGGTGAAGGAGATCCGGCAGTTCTACG
ACGAGAAGTGGTCGCGCAAGCGGATGATCACGTCCATCGACTTTTCGCCCAAGTTCCCGGACCTGATGCTGGCATCGTAC
ACGAAGAATCCAGCAGCACCGCACGAGCCTGACGGAGTGGTGCAGGTATGGAGCCTCAATCTGCACGACCGACCCGAGTT
TGTGTTCCACGCGCAGTCGGACATCCTGACAGCACGCTTCTCGCCCTTCAACCCGAACCTGATTTTTGGCGGGACGTACA
GCGGGCAAGTGCTGGTGTGGGACACGCGGGCACGCTCGGCGCCGGTGCAGAAGACACCGCTGACGGGATCGGGACACACG
CACCCGGTATACGCGCTGGACATTGTGGGGACGCAGAACGCCAACAACATCATCAGCTGCAGCACGGACGGGGTGGTGTG
TGGGTGGGCTGAGAACATGCTGGCACAGCCACAGGAGTTTCTGTCGCTGACGGTGCCGCCACCAAGCAAGATCGACGACC
TGGCGCCGACGAGCCTGGCGTTTCCGGACGCGGACCCGACGTTTTTCCTAGTCGGCTCCGAGGAAGGCACGATCTACCCG
TGCCACCGATACGACCGAGCCGGGGCCAAGGCAGGTGTGGACGCGCGGGTGAGCTACCGGGGCCACGCGGCGCCGGTGAT
GTCGGTGGACTTCCATCCTGCACGCGGGCCGGTAGACCTGGGCGACCTGGTGCTGTCGGCGAGCCTGGACTGGTCGGTGA
AGCTGTGGAAGGTGCGGGCGCCAGCAGCGACGAGTACGGTGGTGGCGGGGGGGGCAGCCGGACCGGGCGTCGGGGGCGGC
GGTGTGGGCGGCATTGGGAGCATTGGCGGGATCGGGGGTGCCGGCAGCGGCAGCGGCAGCAGCAGCAGCGATGGCGTGGT
GACGCCGCTGATGGACTTTGTGCGCGAGGATGTGGTGTACGATGCGGCCTGGTCGCCGGTGAAGCCGGGTGTCTTCAGTC
TCGTGGACGGGGCCGGCTGGCTGGAGCTATGGGACATCACGGTGGAGACGGAGGAGCCGGTGGCACGGATCAGCCCGAGT
CCGCGCAAGGATGGCCGCTCGCTGCTGGCCAACAGTCTCAACAAGGTGGCCTGGGACAAGAGCGACGGGCGGCGGCTGGC
AACGGGCGGCATTGCCGGGACGCTGACCGTGTTTGAGGTGGGGCCGGACCTAGGCGGGAAGGAGAACCTGCGGAGTGAGG
AGTGGACGAATGTGAAGAAGCTGGTGAACCGGCTGGAGGCGGGAGGGAACGGAGGGGGGGTATAGGGGGGAGTGGGCAGG
AAGAAGGGACGAAGAGGTATGGGAATGAGAGAAGAGGAGAGAGGAGAGAGGGAGGAGAGGGGAGAGAGGGAGGAGAGAGG
AGAGAAGGAGAGAAAGGGAGGATAGAGAAGAGGAGAGGAGAGAGAACAGAGGAGAGAAACGGAGAGGACGAAGAACTAGA
GCCAACTCAAGAAGAGCTACTCAATGTATATAAGACACTACAATAATACCCTTTGCATTGGATGTGCACATGTGATGTCA
CATGACATTGAAGTACTCCTTAGGCAAGAGCCTTGAGTACTCCGTACTCCGTACTCTAATCCCCACTAAAGCTCCCCGCC
TCAAGTATCTTACAGAGCCAAGCTATAGCACCGCCAAACCCATCACCACCATGGCTCCATCCACAAAGGTCAGCGAGCTT
CTGGCCGAGGCCGAGAAGACATCAGACGCCGGACCGGCGCTGCTGTCGATGCTGGAGACGCTGCCAACGATATCGAGCGC
GGCCACGATGGCCGACGACCTGAAGGCGATTGGCGACAGCGTGTTCGACCTGTCGACGGGCATCATGTCGGCACGAGCAG
TGCTAGACGGGCTGGTGAAGGCGCTGCGGGACAGCGAGAGCGGTGAGCTGCAGATAGCAGTGGGTGAACACGTGCTGCAG
CGACTGGGAGCAGGATCTAGTTCAGGCTCAGGCCCAGGCTTGGGCTCGGGCTCAGGCTCAGGCTCAGGATCAGGATCCGG
AGGGACAACCCAGGCGAGCTTCCTGGAGCAGGCGGCGACGCTGAGCGAGCTGGTGGCGACGGCACAGGAAGCAGCGGAGA
ACTACGTGGAAGCAGCGCGGCTGCTAGCAACGATTCCGCTGGACGGCAGCGCACGGCGAGTCAGCCAGGAGGACAAGGTG
CGGGTGTGGGTGCGGATCGTGCGGGACTATCTGGAGGTGGATGACAGCACGAGCGCGGAGGCATACCTGAACAAGATCAA
GGGGGTGCTGTACGAGGTGGAGGACGCGGAGCTGAAGCTGCACTTCCGGCTGTCGCAGGCGCGGATCAACGACGCCAAGC
GCGAGTTTCTGGCTGCGAGCACGGCCTACCACGACATCAGCTACAGCACGGCCATCGCCGAGGACGAGCGGCTGCACACG
CTGGGCGTGGCGGTGACGTGTGCGATCCTGGCACCGGCAGGGCCGACGCGCAGCCGCGTGCTAGCCCGGCTTTACAAGGA
CGAGCGAGCTGCCAGCCTGCCGGCCTTTGCCATGCTCGAGAACATGTTTCTCGACCGGCTGCTGACGGCCTCGGACGTGG
CTCAGTTTGCCCGCAGCCTGCAGCCACACCAGCTGGCTACCACGGCTGACGGCCAGACCGTGCTCGCCCGTGCCGTCGTC
GAGCACAACCTGCTCGGCGTCTCGCGGCTGTATCGCAATATTCGCCTCGCCGACCTCGCCGACCTGCTCGCACTGGCCCC
CGATCGCGCCGAGGAGACGACCGCCCGCATGATCGAACAGGGCCGCCTGCTCGGCCGTATTGACCAGATCGCCGCCGTCG
TCTGGTTCGAGGGCGGCGACGCCTCCGGCCGCAAGGGCTCCGGCCGCGCCGAAAGCCGCGTCGACAGCGAGCTCCGCCTC
TGGGACGCCAACGTCCAGAGCCTCGCCGAAGAGGTCGAGAGCATCACCAACGCCATCCAGCGTGACTTTCCCGTACGTGC
TCTGATCGGATCTCGGATCTCGGATCTCGGGTCTCTGACACGAACTGACCACTTGCAGGACTTTGCCGCTCGCAATCTCG
TCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62