GenePrediction:GLEAN_5996 Details

Name: GLEAN_5996
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:626051..624770 (- strand)
Length: 1282
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:626051..625783 (- strand)
Length: 269
Type: CDS
Source: GLEAN
Position: GCSC_82:625690..625368 (- strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_82:625283..625021 (- strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_82:624955..624770 (- strand)
Length: 186
>GLEAN_5996 class=GenePrediction position=GCSC_82:626051..624770 (- strand)
ATGTCGTGGGAATACGATACCTTGCCGCGAGGCGTTCTCGCGGCGCCGCGTTCAAACCACCAGACCTACATTCTGAGCAG
CGTCATCCTGGCCATTTCTATCTTATCGGCACTGGGCGCAGGGTGGATCATACTCAGTTTCGCCGTAAGTCTGACGCCTC
CACCGACCCCCCGAGGATCTTTAGCATCAAGCTCCAGAGATCTGACCTGTTGTGTTAATCGATACCAGTTCTTCAAGCAG
CTTCGCTCTTTTCGACACCGACTTATTCTGTACGAGAGCCCCGTCCCTTTTTTGTAGATGAGAGATGCACACACCTCCTA
AGACAGAGCAGGTATTAATACGGCACACCTCATCCTCACAGTGGTCTCGCGTTCAGCGACTTTGTCATGGCAATTAATTT
CCTGTCTTCGTCCGCTATGAACCTGAATGGCAGAGATATCGGACTAGGCAAGAACAAAACGTTCTGCAGCTACAACGGCT
TCATGACCCAGGTCTTTGTGATCCAGACCGACTACTGGGTGCTGGCGATTGGTATATGCACATATCTGATCCTCTCCGAC
CATAAGATAGCCTCGGTGTGGGCCCAGGACCATGTCCATATCATTGGTTCCTTGCCGTGGATCTTCTCTGTCCTCTGGGC
CATCATCGGACTGGCCACGGCAGGTTATGGCGACATTGGCGCATGTATGCTTTCTTGATTTCTTATTGCACCCCTCCCCT
CCTTCCCACCTGTCAGTACCTGTCAGTGGTAGGCTAATAACCAAACAGGGTGTTGGTTCACGTCGGATAGGGTCCGCCTC
TTCGCCAACTTTATTCCTCGATGGCTGATTATTGTGATTATGCTCATCATGTACGCTCGACTTTATGTAGTCCTGTTCCG
CGCCCATAGGTTCATGTCATCAAGCGATGAAGGAGGCCGCAGAGCAGGTACTACAAACAACAGACGTAGCGATATTGAGG
CTAGCGATCTGGGGCAACAGCAAGCCTTCGACCGAAGAGCTCAAACATCCTCCACAAAGAGACTTAAGAAGGTCAGTTCT
CGCCTTGCTGTTTCCTCCCTTAGCTGAAAGCGAACTGAGATAACTAACCAAAACAGCTGGCGAGGCTCATGATTATGTAC
CCAATGGCATATATCTTCATCTGGACTTTGCCGACGACCATTCGCATCTACCAGGCCTGCACTGGAAAAGCTGCGCCCTT
TGCGGTGCAGACGGTTGACAAGGTAAAATTTGACGTCATGACCCTGTCTTCGGTTCGCCGTAATTCCTCTGCTAAAACAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62