GenePrediction:GLEAN_5997 Details

Name: GLEAN_5997
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:623607..622234 (- strand)
Length: 1374
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:623607..623400 (- strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_82:623323..622937 (- strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_82:622878..622422 (- strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_82:622354..622234 (- strand)
Length: 121
>GLEAN_5997 class=GenePrediction position=GCSC_82:623607..622234 (- strand)
ATGGCGGACCCGGAGCGCCAACATGCCCTTTCGGCCTTCAAGGAGAAGTTGATCGAATCGCGGGAATGGGAGGCAAAGCT
CAAGGCGCTGCGCTTGGAGATTAAAGGCCTACAAAAGAACTACGACCAGACGGAGGAGAACATCAAGGCGCTGCAGAGTG
TGGGCCAGATTATCGGCGAAGTTCTGAAGCAGTTGGACGATGAGCGATGTGAGTGTCATGAACTGTACGACACTGCCCGA
TGATGGAGGATGTGACAACTGACAACATTGGCCTCTTTGTACAGTCATTGTCAAAGCATCTAGCGGGCCAAGATACGTCG
TTGGGTGCCGATCGAAGGTGGACAAGGCCAAACTGAAGCAGGGGACACGTGTGGCTCTCGATATGACGACGCTCACGATC
ATGCGGATGCTGCCACGAGAGGTCGATCCTTTGGTGTACAACATGTCGCTGGAGGATCCCGGCCAAGTCAATTTTGCGGG
TATTGGAGGGCTGAACGAACAGATTCGGGAACTCCGCGAGGTTATCGAATTGCCTCTGAAAAACCCCGAGCTTTTCTTGA
GGGTGGGAATCAAGCCACCAAAGGGCGTTCTACTGTACGGTCCTCCAGGGACAGGCAAGACGCTCCTGGCGCGTGCGGTG
GCCAGCAGCCTCGAGACCAACTTCCTGAAAGGTGCGACGATCATCTCCTGCTTTCTCCTCTTGACGTTTCTAACCTGTTT
TCTACACAGTCGTTTCGTCCGCTATTGTCGACAAATACATTGGCGAGTCTGCGCGCCTTATCCGTGAAATGTTCGGCTAC
GCCAAGGAGCACGAGCCGTGTATCATCTTCATGGACGAGATTGACGCCATCGGTGGCCGGAGATTTTCGGAGGGCACCAG
CGCCGACCGAGAGATTCAGCGGACGCTGATGGAACTCCTTAACCAGCTGGACGGCTTCGACTACCTCGGCAAGACGAAGA
TTATCATGGCGACGAACCGGCCCGACACTCTGGACCCCGCGCTGCTGAGAGCGGGCCGGTTGGATCGCAAGATTGAGATT
GCACTGCCAAACGAGGTTGGCCGGTTGGAGATTCTCAAGATCCACGCAGCGAGTGTGATTACAGAGGGGGAGATTGATTT
TGAGAGCGTGGTCAAGATGAGCGACGGCCTGAACGGGGCTGATCTACGGAACGTGGTGACAGAAGCGTAAGTCTGGACAC
GTCTAAACAGTATGTGCATCGATCAGAAGCTAACAGTGTGTTTTTCCATACAGCGGACTGTTTGCTATCAAGGACTACCG
GGATGCTGTCAACCAGGACGACTTCAACAAGGCCGTGCGGAAGGTAGCCGAGGCCAAGAAGCTGGAGGGCAAGCTGGAGT
ACCAGAAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62