GenePrediction:GLEAN_5998 Details

Name: GLEAN_5998
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:620217..617710 (- strand)
Length: 2508
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:620217..620213 (- strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_82:620132..620062 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_82:619895..619664 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_82:619591..617994 (- strand)
Length: 1598
Type: CDS
Source: GLEAN
Position: GCSC_82:617930..617710 (- strand)
Length: 221
>GLEAN_5998 class=GenePrediction position=GCSC_82:620217..617710 (- strand)
ATGTGGTGGGTCACCGTCTTCCTGATACCTGGCTTGTTTCGATAGCTTCCAGCACGGTGTAGCTAACACACCATCCAATT
CGCAGTGGCATTTTCGGCTACGTGAACTATCTGGTCGAACGGGACCGGAAATTTGTCGTCGATACTCTTGTGAACGGTAC
GCTACCTTTGCATTTTCCCCCTCTATCCCCCTCCCCCTCTCTGTCTCTGTCTCTGTCTCTGTCTCTTTGGAGATCCTTCA
GGATTTGGGATTACCATACTAGTGCAGCTTTACCCCCCTAATTATACTCGACGAAACAGCTAATTAGTCATTGCTGCAAT
AGGTCTCTCGCGTCTTGAATACCGTGGTTATGACTCTGCAGGTCTGGCCGTTGACGGCGACAAGAAGAACGAGGTGTTTG
CATTCAAGGAGGTCGGTAAGGTGGCCAAGCTGAAGGCTCTCATCGATTCTTCCAAGCTCGACCTGGACGAGGTGTTTGAC
TCCCACTGCGGTATCGCACACACCAGATGGGCCACCCACGGCCCGCCGTCTCGCGTGAACTGCCACCCTCACCGGTAAGC
AGGCATCCAAACACTGTGGACATGGCGCTATCTGAGCTGCTGACTGACGATTATGGCTGCGCACAGGTCTGACCCCAACT
GGGAGTTCGCCATTGTCCACAATGGTATCATCACAAACTACAAGGAGCTTAAGACGCTCTTGGAGAGCAAGGGCTTCAAG
TTTGAGACCGAGACAGACACCGAGTGCATTGCCAAGCTTGCCAAGTACATCTACGACCAACACCCACAAATCGGCTTCAC
CGACCTGGCCAAGGCCGTCATCAACGAGCTTGAGGGCGCCTACGGTCTGCTGATCAAGTCCGTGCACTACCCCCACGAGG
TCATCGCTGCCCGCAAGGGATCCCCTCTGGTCATCGGCGTGAAGACCCAGAAGCGGATGAAGGTCGACTTTGTCGACGTC
GAGTATGCCGACGAGAACAGCCCGCTCCCTGCCGAGGCTGCCTCGCAGAACGTTGCTCTCAAGAAGGCCGGCGTCGCCAG
CGGCAGCGGCCTGCTCTCTCCTGAGGCGGCTCTCGGCGGCCTCGCCGCCCCCGACAAGTCGCTCCTCCACCGCTCCCAGT
CACGCGCCTTCATGACGGACGATGGCATGCCCATGCCTACCGAGTTCTTCCTCTCGTCCGACCCGTCTGCCATTGTCGAG
CACACCAAGAAGGTCATGTACCTCGAGGATGACGACATTGCCCACATCCACGAGGGCTCGCTCAACATTCACCGCCTGAA
GAAGTCGGACGGCAGCTCCAACATCCGTGCCATCCAGACGCTGGAGCTGGAGCTGCAGGAGATCATGAAGGGCAAGTTCG
ACCACTTCATGCAGAAGGAGATTTTCGAGCAGCCCGAGTCGGTCGTCAACACCATGCGTGGCCGCCTGGACATTGAGAAC
AAGAAGGTCACTCTCGGCGGCCTGCGGTCATACATGTCGACCATTCGCCGCTGCCGTCGCATCATCTTTATCGCCTGCGG
CACCTCGTACCACAGCTGCATGGCTGTGCGTGGTGTTTTTGAAGAGCTTGCCGAAATCCCGATTGCTGTCGAGCTGGCAT
CCGACTTCCTTGACCGACAGGCGCCTGTCTTCCGAGACGACACTTGCATCTTTGTGTCGCAGTCGGGTGAGACTGCCGAC
TCGCTGTTGGCCCTGCGGTACTGCCTGGAGCGTGGCGCCCTGACCGTTGGTATCGTCAACGTTGTCGGCTCGTCCATCTC
GCTGCTGACCCACTGCGGCGTGCACGTCAACGCTGGCCCAGAGATTGGTGTCGCCTCGACGAAGGCATACACATCGCAGT
TCATTGCCATGGTCATGTTTGCGCTGTCGCTGAGCGAGGACCGCGCGAGCAAGCAGCAGCGGCGCGAGGAGATCATGGAG
GGTCTCGCCAACGTGTCGAGCCAGATCAAGGGTGTGCTTCAGCAGGACCAGGCTATCAAGCAGATGTGCCAGCAGAAGTT
CAAGAACCAAAAGTCTCTTCTCCTGCTTGGCCGTGGCTCGCAGTTCAGCACGGCTCTCGAGGGTGCCCTGAAGATCAAGG
AGATCTCCTACCTACACTGTGAGGCCGTCATGTCGGGCGAGCTCAAGCACGGTGTGCTGGCCCTCGTGGACGAGAACCTC
CCGATCATCATGATCCTCACCCGCGACAATCTTTTCACAAAGTCCCTCAATGCCTATCAGCAGGGTGAGTTACCTTTTCT
GCCTCTGCCCCCCTTTTGCAAACGACCACGCATCTAACTAGTTACAGTGATTGCTCGTGGTGGCAAGCCGATTGTCATCT
GCAACCCCTCCGACAGCGAGTTTAAGACGTCAGAGGCGGAGAAGATCGAGATCCCCAAGACCGTGGACGTTCTCCAGGGC
ATCTTGAATGTCATCCCCCTGCAGCTGATTGCCTACTGGCTGGCCGTTCTGGAGGGGCTCAACGTCGACTTCCCGCGCAA
CCTGGCAAAGTCCGTCACGGTCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62