GenePrediction:GLEAN_5999 Details

Name: GLEAN_5999
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:616084..615122 (- strand)
Length: 963
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:616084..616013 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_82:615949..615122 (- strand)
Length: 828
>GLEAN_5999 class=GenePrediction position=GCSC_82:616084..615122 (- strand)
ATGGCTGGACTTGTTGCGTATGCAAGCAGCGATGAGGAAGAAGACGTGGCTCAGGAAGAGGTGTCATTGAGGGTAAGCTA
CGACGTGCCCCGATCCATTTAGAAATGCTGGACTTGCCCTGTGTTGACAAAACAGATTGCGGGTAGCCTACAGGCCCAAC
AGCCAGCCAGTCCTAGCGAGGCGCCAGACAGCGTGAAGCCTGCTGCAGGTGCTGAGGGGCAAGCATCTTTGGAGACGCAA
CGGACAGGGACACCTCCAGCAGAAAGCTGTGAAGACGGGCAGCTTCAGAAGGATGTGCCGGACCTGGGAACTCGCGCCGA
TGAATCTAACGTCTTGATCGGCCCTGCAAGGCCGGATGGCAGTAACGGTGCAGCGGCACTTCTGCCGGCCGACGATGACG
ATGACGGAAACAGCAACGGCGATGGCGACGGCGAGCCACCGCTGTCTCCGTACTCGGCCGAGCGGGCTCTACTGCGGCAG
CTGACGCTCCCGCGTGTGGCGGATTTTGCCATCCCAGGCAGCCCGCCCGGGACGCCGCCGCCGGGCCTAGAGACGCTCAG
CAGCAAGTTCGACACGTTTCTGGCGCTCAAGCGCGACAAGGCAACGCACTTCAACGCGCGTCTAGCGCAGTCCGGAGCGA
TGAAGAACCCAGCCGTGATGGACAAGCTGATGGCTTTTGTGGGGCTGGACGGCACAGGGCCGGCACAGTATGGCACAGTG
CTGCCAGCCGAAGTCTGGAACCCAGACGCGGAAGACAGGACAGCGCCCGTTTTTCCCGACTGGGCTTACCGACATCCGCT
GCGCAAGGTACAGGAGGAGCTGGGACGGCAACGGGCGCGGGCGGCCGGGGAGCGGGTCGAGTTTGTAGTAGCGACGGCCT
CGCGGACTGGCAGCTCGGCTGCAGGGACAACAACAGCATCAATAGGACCGATCACCGGGAAACGGAAGAGCAGGTTTGAT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62