GenePrediction:GLEAN_599 Details

Name: GLEAN_599
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:858644..859498 (+ strand)
Length: 855
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:858644..858716 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_97:858788..858807 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_97:858866..859084 (+ strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_97:859151..859498 (+ strand)
Length: 348
>GLEAN_599 class=GenePrediction position=GCSC_97:858644..859498 (+ strand)
ATGGCAGCTCGAGGTCCTGCCGGTGCGCGCGGCCTGAGCAACCGGTTTGCCCAGTTCAAGCTGGTCCTGCTGGGTATGTC
TGCTCGCGGCCGTCGTTGTCTTGTCTCTTGTCTCGCCCGATGCTCGATGCTAACAGGTCTGCAGGTGAATCTGCAGTTGG
AAAGGTGTGACCTGCCATCCCTCTCGTCTTCGCACCAGCCCCAGCTAATTAGCCCCCTGCAGAGCTCCATTGTCCTCCGC
TTCGTCAAGGACCAGTTCGACTCGTACCGGGAATCCACCATCGGCGCCGCCTTCCTGACCCAGACCATTTCGCTCGACGA
GACCACGACGGTCAAGTTTGAGATCTGGGATACGGCCGGCCAGGAGCGGTACAAGTCTCTGGCACCCATGTACTACCGAA
ATGCAAACTGCGCCGTCGTTGTGTACGACATTACACAAGCCGTAAGCATTTCTTTCTTTTAGGTCTCCCCCCGCAGTCTC
TACTCTCTCCCCTGCTCACACGCCCAGTCCTCCCTCGACAAGGCCAAGGCCTGGGTCAAGGAGCTCCAGCGCCAGGCCAA
CGAGAATATCATTATCGCGCTGGCCGGAAACAAGCTCGACCTGGTAACGGAGCAGCCGGACAAGCGGGCAATTCCCGAGG
CTGAGGCTGAGGCCTACGCAAAGGAGGCCGGCCTGCTCTTCTTTGAGACGTCAGCCAAGACGGCCGAGAATGTCACGGAG
CTGTTCACGGCGATAGCAAAGAAGCTGCCGCTCGACCAGGCCGGTCCCGGACGTGCGCGGCCAGGCCAGCGACCGGGCGT
CACCCTGGCCCCCGAGGGCGCCAACACGCAGTCTGCTGGTGCGTGTGCCTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62