GenePrediction:GLEAN_59 Details

Name: GLEAN_59
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:399481..402987 (+ strand)
Length: 3507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:399481..402987 (+ strand)
Length: 3507
>GLEAN_59 class=GenePrediction position=GCSC_179:399481..402987 (+ strand)
ATGTCGAACAAGTATGGTAATTCGTATCGCGGCAACGCAAACGGCTATGGCAACTTTGGCCGGCCGCAACAAGCGCCGCC
ACAGCAGGCACAGCAGCAACAACAACAACGACAGGCGCAGCCGCAGCAGTCACCGAAGCCGACGGCACGACTGAGGCCCA
GCGACGACTACGACCCGTACGGCGACGGATACGTGAGTTCATCATCACGAGAGCGGTCGCGCGGGCCGGCCTCACGCGGC
GCGGCTGGACGATTCAAGCAGGCAGAAGAGCAACAGCAGGCGCCACCACAGCTGCCACCGCCACGACGACGACCAGAGCG
ACAGATCGGACAGGAGACGCTGGACCACATCCGAAAAGAATGGCCGTCGATGTGCGAGGCAGACTGCGTACCGGTGCAGA
TGGCGCTGCAGCTGCTGGACTCGAGCTCGGTCGGACGAGCACACGAATACCGGGGTTTCCAGGAGACGCACCAATACCTG
CAGGACTCGCTCAAAGGCATCGTGCACGACTACCACCAGGGCTTCAACAGTTCGATCGGAACGTTCCACAAGATCCAGAA
CAGCATCCAGACGTCGCAGAAGAAGGTGCGGTGGCTGAAGGAGACGCTGGCGGCGAGCAAGGTGAACCTGTGCAAGACAG
ACCCGGAGCTGAAGAAGCTGTACGCGTCGTCACAGATGTACGACGACCTGCTGCAGACGCTGAACGACGTGGACGAGCTG
CGACAGGTGCCGGAGCGGCTGGAGGCGCGGATCTCGGAGAAGCAGTTCCTGACGGCGGTGGACGTGTTGCAAAACGCGCT
GCGGAAGCTGCAGAAGCCAGAGCTGGACGGGATCGGGGGCCTGAGCGAGCTGCGCAGCTACCTGGCGAACCAGGAGACGG
CGCTGATGGACATCCTGGTGGAGGAGCTGCACGAACACATGTACCTCAAGTCGCCGTACTGCCAGGAGCGGTGGCAAGCG
CTGGCAAAGCACCAGGGGACAGCCAACGAAGCGTACTACGGCAACGCGGCCTCGACGGTGGCGCCGTTCTACGCGCTGCT
GGACGGGATGGAGTTTGAGCACGCGGTGCGCGAGGACCCGGCGCGCAACCCGGAGCGGGACACGTTCTACTACATCACGC
TGGTGGTGGAGTCGCTCAACAAGCTGGGCCGGCTGGAGGGTGCGGTGGACCAGCTGAAGCAGCGGCTGCCGGTGGAGCTG
TTTGGGGTGGTCAACGAGGCGGTGACGGAGGTGGACCGCAAGCACCCGAGCTCGCTGCGTGGCGGGTCGTCGGCGAACGC
GAACGGATTGCACATCTACGGCAGCCGGGAGACGCAGCTGCGGGCGGACGTGATCTACGATCTGCTATGGACGCTGTACG
GCAAGTTTGAGGCGATTGCCGAGGGTCACCGGGTGCTGCACGAGTACATCAAGGCGCTGATCCGGCGCGAGGGCGCGGGC
AACAACAGCGCGCTGCTGGGCAGCTTCAAGGAGCTGTGGAATCTATACCAGAACGAGATCCGGTCGCTGCTGCACAACTA
CGTGACGACCGACGCAGACCTGTACCGGTTCAGCAACTCGCCGATGTCGGGAGCCGGCGGCTATGGCGGAGCGGCGAACG
GCGGACGCAAGAGTATTTTTTCGTTTGCCGAGTCGGACGCGCGGTCAGACGAGATGGCGGCCGAGTACGAGGCGCTGGAC
GGGATCATCCGGTCAGCGGTGCCGGGACTGACGAGCGACGACGGGACAGGGAGCAGCAACCGGCGATCGGGGTCGGGCGG
CAAACGAGGCAGCTCCAAGATCATCAGCTTCGGCTACGGGACAGCATCATCACAGCATCAGCATCAGCACCAGCAGGACG
GGATGCGCAAGCCGCTGGTAGAGCCGAGCGTGTTCAACATGAGCCTGCTGTTGCCGCCGACACTCGTCTTTCTGCAGCGG
CTGAAGAACATTGTGCCACCGGGATCGGACCTGGCGACAAGCACGCTGACGTCGTTTCTGGACAACTTTCTGGTCAACGT
GTTCCAGCCGCAGCTGGACGAGACGCTGGGCAAGCTGAGCGAGGCGGTGTTTGGCGAGGCAGACGCCTTCCAGCCAGACG
CACAGTGGAGCCAGGTGGCACGCAAGCCGGTATTCAAGGGCACGACGGCCTTTTTCTCGGTCGTCACAGCCTTCTGTCGG
ATGCTGGGGACGATTCCGCACGACCAGGCGCTCAGCACGCTGATCATCACGCAGATGATGCGGTACTACGACCGATGCTT
CAGCTGGTACAAGGCGCTCGTGACGAAGACACCGGAGCGAGGCGTCGAGGTGGAGGGAGGAGAGGGAGGGGGTATAGTGG
AAGGAGAAGGCAGCGTGGGCGTGGGTGTCAGTGTGGGAGTGGACGGCGACGGAGACGACACGACGCGACTGCGGCTATCG
GCAGTACTGGCGCTGGAGGACGGCGACGTGTCGCGAACAGCGAAGCAGTTGTGGGAGGCGACAGGAGGAACGACAGGGCC
GACAGAAGGGCTGCTGGGCCAGGAGGCGGAGCAGCTGATGAGACGGGCAGCACGACAGGGCAGCAGCGGACGGCTGGACG
TGAGCGACGTGATTGCCGACCGGGAGACGATCACGTCGTTGTGTCTGCTGTACACGAGCATGAAATGGCTGGCGGTCAAG
ATTGCGGGACTGCGACACATCACGCAGCAAGACGCGGACTCGGCCTCGACGCGGTCGTCGTCGTCGCTGACGAAGCCGGG
ACGACGACGATGGACGCTGCTGCACGACGCGAGCCGGGCGTTTGCGGGTGGAGGAGCCGGCGGTGTGGACGAGGCAGCCG
GCGGGGGGCCGGTGTACCTGCCGATGACCCAGGAGACGGCGCAGTCGTTTGACGGGATCGTGTCGTCGTGCGAAGAGCTG
GCAACGACAGCTCTTTTGACGCTGCACCTGGAGGTGCGGTGTCGCATCGCATACGCGCTCGGCGTGGCGCTGTCGCCGCA
GACGGCGCCGTATCTTCTGGACCAGGAGGTCAGCGAGCCGGATCCACAGATCCTGGCGCTCAACGGGGCGCTGATCGCGT
ACGACGAGACGGCGATGCGGTTTCTGCGCGAGCGCGAGGCCAACTTTGTGCGCACCGGGCTGGGCCAGCTGGCGGGCGCG
TATCTGGTGGGCAACGCGCGCATGGTGCGGCCGATGAACAGCAAGGGCTGCGGGCGGATGCAGCTCAACATCCTGGTGCT
GCAGCAGAACCTCAAGAACGTGGAGGAGGGCGTGGACCTGGCGCGGGCGGCGAACTACTACCGGCTCTTTGAGCAGGGGC
CGGACGCGATCGTGGCCAAGGGACGGGAGGGGGGTGGGGGTACGGGTGAGGGCCAGGAAGCCCAAACGGACGAGGCCAAT
ACGTTCTCCTACGATGAGCTCAAGGAGCTGATCGAGCTGTACTACTCGGAGCAGCTGGCGAACCCGGAGCGCGGAATCGA
GAACGCGGCACGGCGGCAGATGGGGGAGAAGCTGATGGAGCTGGGAGAGCATTCGTGGCAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62