GenePrediction:GLEAN_6000 Details

Name: GLEAN_6000
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:598690..597864 (- strand)
Length: 827
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:598690..598538 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_82:598478..598104 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_82:598040..597864 (- strand)
Length: 177
>GLEAN_6000 class=GenePrediction position=GCSC_82:598690..597864 (- strand)
ATGTTCGCCAGAGTCCTTCTCCTCGCGCTTGCCGCCTCTCCTCTCGTTGCCGCTCACGGAAAGATCGCCGTCATCACGGG
CGATGCTGGCGGCAACACCACTGCTATCGGCATCAAGGGTGCTGTCATTCCTGGTGCCGGGTCCAATTCCAAGGTCTGTG
ACTACCACTGTTCTCTGCATACACAATGGCAGGCCATGCTGACTCGTCCCAGACGGAAGTCGACACCACCGTCTTCAGCT
CTACCAAGATCGCCACCAACGGTCTGGGCAGGACCAACAGCCAGGGCAAGAACACAGTCTCGATGGTGGCCCAGGCGCAG
GAGCTCTCGGGCTCGACGCTGCCACAAGTCTCGGCTACCAACGGCTCGCTCTCGGGTACCTTTCACATTGTCACCACGGA
CGGCGCCGGCCCCCTGCAGGCCATTGTGGACACGACTGGCACCGGCGCCTTTGCCAGCGGCACCAAGGCCGAAATTCTGA
CCCAAGTGCCCGGTGACGGCGGCGAGATCAAGTCATCAGGCGTCGTTCGTCGATTCATGGTCAAGGTGGGCATCGCCAAA
CGGGCGGCCAACGTGAACAAAGACTTTGTGAGTTTCTCTTCTTTCTCTTCTTCTCTTCTCTCCTCTCCTCTCACTCGCTG
ACACCCACAGCCTGTTGCCGTCTCTATCCCGGCTGGAACTACCTGCAACGGCACAGTCAACGGCCTGTCCAACGTGTGTC
TCATCAAGATTGCCAACTCCAACTCAGCTGGACCGTTTGGTGGTGTCGTGGCCTTCCAGATGGCCAGCAACACCACGGTC
AAGCGCGCCGTCGAGTTCACCTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62