GenePrediction:GLEAN_6001 Details

Name: GLEAN_6001
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:590464..589640 (- strand)
Length: 825
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:590464..590349 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_82:590279..589640 (- strand)
Length: 640
>GLEAN_6001 class=GenePrediction position=GCSC_82:590464..589640 (- strand)
ATGTCGCCTCCCGCCATCATTGCGCCGTCGATCCTGTCGGCCGACTTTGCCAATCTCGGCCACGAATGTTCCAAGACGAT
TGAGCAGGGTGCCGACTGGCTACACGTGGACATAATGTAGTCTTCTCTCGTTACCGGTTTCCCTCTCCCTCTTCCCTTTC
CACCACGTTCGCTCACAGCTCCCAGGGACGGTCACTTTGTGCCCAACCTCACATTTGGCCCACCTGTCGTCGCCAAGATC
CGGTCGCATGTCGCAGCCCCGGGCACCGACGCCCCTCTGGGTCGCGGCACCTTTGACTGCCACATGATGATCGCCGAGCC
GAAGCGATGGGTGCGCGAGTTTCGCGACGCCGGCGCCGACCTGTACTGCTTCCACTACGAGGCCGCCTTCTCTACGGCCG
CCGAGACCCCATCGGCCCAGTCGGATGCCAGCACTACACCGGCCGAGCTGGTGCGCTACATCCACAGCCTCGGCCTCCGA
GCCGGCGTCGCCATCAAGCCGGGCACGCCCGTCGACGTGCTCTTCCCGCTCGTCGACGTGGCCGATGCCGCCGATCGTCC
TGACATGCTGCTCGTCATGACCGTCGAGCCCGGCTTCGGCGGCCAGAAGTTCATGGCCGACCAGATGCCCAAGGTCCGCA
CCCTGCGCGACCGCTACCCCGACCTCAACATCGAGGTCGACGGCGGCCTCGGACCCGCCACCATCGACGTCGCTGCTGAG
GCTGGCGCTAATGTCATCGTCGCCGGCTCTGCCGTCTTTGGCGCTGCCGACCCCGCCGACGTCATCGCCAAGCTGCGGGC
TGCCGTCGAGGCAAGGAGGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62