GenePrediction:GLEAN_6002 Details

Name: GLEAN_6002
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:586591..584210 (- strand)
Length: 2382
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:586591..586435 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_82:586337..585644 (- strand)
Length: 694
Type: CDS
Source: GLEAN
Position: GCSC_82:585590..584210 (- strand)
Length: 1381
>GLEAN_6002 class=GenePrediction position=GCSC_82:586591..584210 (- strand)
ATGCTCATGGGCGAGGCAGGTGCCGGCAAGACAACCCTGTTATACAGCCTCTGCGGCTTTCAGGACTTTGCTACAATCCC
TACGATTGGTTTAAATGCGGAGGATATTACTCTCCGCGATGGATCGGGATGGAAGTTCACCTTGTGGGATCTGGGTGGTA
AGCCTTCCAAACGTAGATCTTGTTTGATAAAGAGTGAGCAGGAATACAATTAGACACCGGCTGACATTGTTGACGTGGTC
CCTGGTATTGACAGGCGGTTGTGGGAAGCAGAGACCGCTCTTCAAGCACTATCTTACAGCAGATAGGTTTTGTGTCTTCC
TGCACGATATCGGCCAGGACAATTGCGCAGAAGAATCCATTGCAGCTTTCCAGGGTGTTCTGGAAGACTGTTCATCCGGT
GGCTGCAGGCACATTTGGGTAGTTTTCAACAAACAAGATTTGATCAGGTCGGAGGACGAGCGATTGGCAAAACTAGGAAC
CATGGCGGGCAAGTACCGAGATCTGGCTGCGCCGTTTGCAGACAAGGTCCAGGTGAGAATCTTACTGCTTCCGGGCTTTG
ACGCAGCCAAGCACATTCGGATAGACGATATGCTGAGCGAGATCCGCAAAGCGCTGCAGCAGGAGGCCAAGCTGGGAGCA
GTTGGGCATGGCAAGGTTGCGAGAGAGGCGAGCGCCGAGGCCTCTCCTAGCGAGGAGGACCTGCGAATTGCGGTAGAGAT
GGCCGTGGCCGGCCAGCGCGAGCAGCCTTCGGATGCGTTTTGGGAGAATTTTTTGGGGGGGACTCTGACCTCGTGGGACC
ATGCATCACATCTCCGAGCAGGACTGGGCGTAATCCTTGAAGGCTATCTGAAGCCGAGAGGACTCTTCGCGTGGACGGAT
GATTTCATCGGCCATCTGGATCGACTGCGAGAAGACCGGCCTGATCTCTTTCGCAATACGGCACACAGGTAAGCCCCCCG
CCTGGAGTCTCGCGCAAAGGTGGCGGCATCTGACCTGTCAGAACTATGACCATGTTCTGGCTGCACCGGATCCACGGAGC
CTTGAAAGGATACATGGCGAGCACGATAGCCGCCCATAGCTCCCAGAAGACCTTTCATCTTCCCCAGCTCGACGAGTTTC
CCCCGATCTTGCGAGCGGACTGCCGTCTGATGGACAAAAACCTCTGGCGGCAATTCTATTCGCAGGGTCTGATGTTCAGT
CCGCGGGCCAAGAATGAATGGTGCCTGCCCGACCTCGCCATGCTGCCGGACACGATCACGGCGCCGTCGACCAGTGTTGT
CCACACGGCGGGAAGTCTATCGGGGTCCAACACGACCGGACTCGCCGGCGCCGATCTGCGGCTACCCCGGTTTGCCTTCA
CGGTCGTCAAGAAGACGCTTTCTTCCGGATCTCGCCGCGGTCGCATTGTCAAACGCGCCCTCGAGGTCCTGCAAAAGGCC
ACGATGCGCCAGCGGGCGGCAGCAGCTACGGGCATGTCACCGTCGCCACCGCCGCCTCCATACTCAGAGACACAGGCCTA
CTTCTGGATCCAATATGTGCATGCGTGCCTCACTGTGCCCAAGAGGGACGGATTACCACCGCTACAGAAAGAGCTTCCAG
ACTACGGCTCGTTGCGGAACCTCAGCTTTTCTGTCTTTCAAGCCATGTTCTCACTGCGCGGAGACGAGTGGCGGAAGTTC
TACACGGCGCAGCTGTGGGAGGGCGTCGGGTCGCGGCCGCAGATGCTGCTGCCAGACCGGAGGCAGCTGCCCAACGTCTT
TCCGGTACCTGACAGCCAAAGCCTAGACCGTGCCAAGAGCATGCTGGTGCAGGAAGTGTACCAGGCCACGGGAAGTTTGG
AAGATGGGGTGGCGCCGACCTTGGAGAAGATGACGGAGGAGGAGCTTGCATTCTTTGCAGATCTGGTCGTAGACGAGGCT
GAGCAGCTTCCTGAGGATGAAGGGGCAGCCGCACTGACAGGCCTGAACGGCGATGACAGCGACAAGACGCGGACAGACCA
GATTGGCGGTCAATACCAGACCATCGCCCGTGCAGAGCTGCTGCTGTTTATCTTCCGCGGCTTAACAAATGCTGACATAA
GCACACATGCGGCCTTGTCTGATGTATCTATCCGCATTACCGGGCTGTTGCAGTCGGGCTGGCACCGGTGCAGCGGCGTC
ACGCAGGCGTTCTTCTGGGTGCGCATGGTCCTGGGGGCTCTGCTGCAGCGGCGCGAGGACATGGCCAGAGTCGCATTTGG
CGAATTTGTGCGGCAGCACCCAGAGCTGGCACTGGACGGCCTGCAGTGGACGTACTATTCACCTGAAGTGTGGGAGAGCG
TGGAGGCAAAGGACACATACGTGATGCCAGATAGGCAGGCCCTGGCAAGCACGTCAATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62