GenePrediction:GLEAN_6003 Details

Name: GLEAN_6003
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:583345..581480 (- strand)
Length: 1866
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:583345..582334 (- strand)
Length: 1012
Type: CDS
Source: GLEAN
Position: GCSC_82:582143..581995 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_82:581941..581480 (- strand)
Length: 462
>GLEAN_6003 class=GenePrediction position=GCSC_82:583345..581480 (- strand)
ATGGGACCCGAGAAGACGCAGTCGGTCGCCGATGTGACAGAGGCCAGTCCGGACGGCGAGAAGGGCCAGGCGCTGTCGGT
GACGTCGTCGTCGTCATCGCAGCAGGCAGACAAGAAGGAGGCGGTGGGCAGCATCGCGGCGGTGCTGCGGCACGCGGACC
AGGACGATGCGGACGAGGCGTTGAAGGTGCTGCGAGCACAGGGCAGCTCGGTGCGGCCATTGACAGCAGCCGAAGAGCGG
CGGCTGGTGCGCAAGATCGACTGGCACCTGATGCCGCTGCTGTGTGTGGTGTACGGGCTGAACTTTCTGGACAAGACGAC
GGTGTCGTATGCGTCGGTGATGGGGCTCCGAAAAGACATCGGGCTCGTCGGACAGGACTATGCCTGGGTGGCCAGCATGT
TCTACTTTGGCTACCTGGCGTGGGAGTGGCCGACGAGCCGGCTGCTGCAGCGGCTGCCGCTGGCCAAATGGTCGGCCGCC
AACGTGATCATGTGGGGGCTCGTGCTCTGCTGCATGGCGGCCGTCCGGGACTTCTCGCAGGCCATGGCGGTGCGCTTCTT
TCTCGGCGTGTTCGAGGCGGCCGTCAGCCCCGGATTCGCCCTGCTGACGAGTCAGTGGTACACGGCCGGCGAGCAGGGCG
TGCGCGTGGGCATCTGGTTCAGCTTCAACGGCGTCGGCCAGATCGTCGGCGGCCTTGTGGCCTATGGCATCGCTGTCGGC
ACCAAGCACCATCCTCTGGCCCATGGGTTGCACCCGTGGCAGCTGCTCTTCCTCGTCATCGGCTTCTTCACCGCCGCCGT
CGGCGTCGTCTTTTTGCGCGTCATGCCTGACAACCAGATGAACGCTCGCTTCCTGACGGCAGATGAGCGTGTTCAGGCCG
TCGAGCGCATTCGCGGCAACCAGCAGGGCGTAGGGAACAAGCACTTTAAGTGGTACCAGTTCCGTGAGGCCCTGACCGAC
CCTATTGTTTGGGCGTTTGTGTTTTACAGTCTGGTTGCGGATATTCCTAATGGTGAGTTTTTTTATTTCTGCACTTTGCA
CTTTTTTATTTCTTTATTTATTTCTAATCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTTCTTTCTTATTCTTTCTTTCTACTTTCTTCCTCCTCTTCTTCCTTTTTAAACCCCCCCCACGCTAACCCCCT
AGGCGGCATCAGCAACTTCTTCTCTCAGCTCATCGTCTCCTTCGGCTTCACCAGCGAGCAGTCCCTCCTGCTCGGCATTC
CTGGTGGTGCCATCGAGGTTATCGCCTTGATTGCCGCCGGCTTTCTGGGAGACCGTCTGAAAAACCGGCTCGTAAGCCTC
CTTTCTTCCCCTTTTGTCCCATTCTCACTAATGTCTCCCCCCAGCTCGTCTGCACTTCCGGCCTGCTCATCTCCATCCTC
GGCATGCTGCTCGTCACGTGCCTCGACAACCATCATCGTGTCGGCCGGTTGATCGGCTACTACTTCACCATGGCCTCGCC
CACACCCTTTGTGGCCCTGCTGTCGCTGGTGGCCACCAACATCGCCGGCTGGACCAAGAAGACCACCGTCGCGGCCATGT
ACCTGATCGGCTACTGCGTCGGCAACATCATCGGCCCCCAGATCTTCCGGGACAAAGACGCCCCTGAATACCGACCGGCC
GAGATCACCATCATCGTCTGCTGGGCCCTCGCCCTGCTGGACATCCTGTTCATCTACTTCTGGTGCCGGCGCGAGAACAG
CCGCAAGGCCGCCATCCGCGCCCACCCCGGCTACTGCAAGCTGGAGGGCCAGGAGTTTTACGACTTGACCGACCGCGAAA
ACCCTGAGTTTGTCTACAGCCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62