GenePrediction:GLEAN_6004 Details

Name: GLEAN_6004
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:577098..574788 (- strand)
Length: 2311
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:577098..577012 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_82:575060..574788 (- strand)
Length: 273
>GLEAN_6004 class=GenePrediction position=GCSC_82:577098..574788 (- strand)
ATGCTCCGTACGGAGTACTCGTGCCAGAGACGGAAAGCTCCGCAGGACGAGGCCGGCGTACCGGCTGGATGTATCTTACG
AATGCAGGTCCGTATGCCACACGCGCGGCAGCCTCTCGGGATAACATCCGAGCAACGAGTTCGCCGAGTCGACCCATGTA
AGGGATGTCTGTGTCAAGCCTGCTCGGGAGAAGGACCCGTAGACTTCCGATGCGGTGTGCACGTCTGTCTCAAAGTCTTT
ACAAACGAGCATGCTACATACTGCGATGGGGCCCGGGGTCTCGTGTGAAAGTGAATCTGGCCCTGTGAGCACGTCAGGAA
CAGAAATGGCCTGTCAGGCGCATAGGTCCCGCTTCTCGCAATACGATACACCCTTCTCCGGCCTTTAGACGCACACGCCG
GCGGGGAAGGGCAGCACGAGGAGAAAAAGTCCTGCCCGCTCCGCCCTTCTCCTCGGCTCCCGTTTCCACACTCAGTTCGG
CTTGCCCAATGCAGTAGCTCTGCGCGGTGCGAGGTGTGACAGACCAGACCGGCGGTCCTTCCAGTCAGTTCCGGACGAGG
CAGGAGTCTGCTCCCATTGGATCGCTTGCTTGCATATGTGCATGTACATGCATGTGCGTTCGCATTAAAGGGGGACAGGT
GCAGCGCGGGAAGCCGTGGCGCTAGAAATGGAAAATTGAAAACCGAAAATTGGATCTGGAAATTGTGGGTGGCGAGGCGA
CCCTCTTGGGCGACTAGCCGGCTGGCTTGGGAAACCGCTGCTGCGGGTGCGGTGGAATCAGGGAAATTGGCTGCCGCTGG
CTCGGATTCACGTGTGTTTGACGCCTTCTTCCTGCTGCCTCGTCCAGGCTCGCAGAAGCCGGCTATACTCTCTTTCCCGT
CCTCTCACGCCATTTCTCGCGTACGAACAGGGTCGCTCACCGGTGTCTGGGTGGACATGTTTCAATCGGGGAAGAAGAAT
AGCCGAGTTCGGTCGCCGATCGTATACACCGTACTCGTACTCGTACGGTTGGTGCCTTTGAGACGAACCCTGATGCCGAT
ATAAGATATTCTAGATCAGAGTGGGGCAGGCTCTCTCAATGTTCGCCCGAGAGGACCTCGGGTGCTCTTATACATATCGA
GGGACAGACCGTGACGGCAGCCAAAAACGCGCTTGGGCGTGTCGGCTGGCGAAGAGTCACCACAGGCTGACGTCAATACT
GCGAAGCTCGTGGGAGGCGAGATCGACATGGAGCAAGGTGCATTGCCGATCCTTCGTATGTACGGAGCACCCATAGCGTG
CTCCGTTCTTTCTCCATGTTGCTGACCGTTTTGTCGGCATCCTAGCCATCTCCCTTCCCCACCCATTGGTCTCGGGGTCA
AGGTGTCAGGACTCTATCTTGACCCCGAACAACTGCCACACGTCCGTCGTAGATGCCTACGAGTACTCCGTATGTTTTCT
TTGATTGAGGTTCTATGTAAGCGAGCTAGAAGGAGGTGGAGAAGGACGCTAGATCTTTGCCAAAGTACTCCGTACGGCTC
GCCTAAAAGAGGCATTCCGATACGAACAAAGAGAGGCGACCTTCCCAACAGGCTGTATTTCTCCTCTTCTTTGCTCGCTT
CAGGGATGCGGGGCAAAGAGGACTTCTGTTGCGGTTTGCAATGTATCTTGCATTCCGACCGTAGGGCACAGCTGCACTCG
TGCCGTTGGAAGCCGTTGACCTCTCCCCGCATCTGGACTAGACCACGAGGAGAAAACATGGTGACAAACGGGAGGGGAAA
CACGAGGAGGCGACGGAGACGTTGGGGAACTGCAGAGGGTGTTGGTCGCTCCTTCCCAGCAGACGTCTGTGTGAAGTCAG
AACAGGAAGCAGAAGCGAGCCGTCATGTTCTTCTTGCGGCTGCCATAAACGCGTGAGTGCGAGACATCCGGGCTGTTCGA
TTCGTGATCGTCATATCACGTGACATCTACAGAAGATTATTGATTGACCTCGCAGCCGACAATGGCCACCACCGGCCGCA
ATTCTGGGCTGTCCAGAGGCTGACTGACGGCAGCCTAGTGCGTGCCCGCCTGGTCTCGTTATCGTCATCGTCATCGTCGA
CCGGGCCTGCTGGAGTTCAGCCTACAGGGCAAGGTGGCCGTGGTGTCGGCTGGGGCTTTGGTGCACGTGATCGACCGGTT
GACGTCGCCGGCTGGCGCGTTTGGCGAGATGGCAGCGCGGGCAGCGGCGGCGACAAGCACGGGAAGCGAGCGGCTGGACG
GTCTCGTGGCTGCGGCGGGCATCCAGCAGGAGACGGCCGCGCTCGACTACACGGCCGCCGACTTTGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62