GenePrediction:GLEAN_6005 Details

Name: GLEAN_6005
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:571568..570685 (- strand)
Length: 884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:571568..571245 (- strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_82:571170..570685 (- strand)
Length: 486
>GLEAN_6005 class=GenePrediction position=GCSC_82:571568..570685 (- strand)
ATGATGAATCCGCGGCAGTCCTATGCGCCGCTGCCTCCGAGCTATGTGCCGAACACGTCGCTTTCGGCCACGATTAATCT
CGACGAGGAGGTCAAGCTTACGGAGACGCGGGCCGAGCGCGACCTGCAGGAGTCGCTGGCGGAGATCTTCAGCATCATCG
TGACGATTGACGAGCTGGAAAAGGCGTTTTTCAAGGATGCCGTGCCTGAGTCGGACTACACCGAGATCTGTGAGCGGTCG
CTCAAGCAGTACAGCTCCATTCTCAAAGACGACGCTGTGCTGCGTGCCTTTGGCGATCTGGACCGGTTCAAGCAGGAGTG
GGATGTGAGTGTAGCTGAGGACTAGCAGAAGCAGAATCGTCTACAGCAGCAGACGTGACTGACAGCAGGCGTGTGCAGCT
CGAGGTGCCCCGTGCCACCGAGCGCATCCGTGTCGGCATTCCGTCGACGGCCCTGACGACGTCCTCGAACGGCAACGGCA
CTGGTGGAAGCGGCAGTGGTGGTCTGGGAGGTGGAGGCGGCAATATGAATAACGGAGGCAATGGTGGCACTGGAGGTGGT
GGTGGTGGCGGTGGCAACAGCAAGAACACGGGCACGACGAGCGGAGCGCTGATCCTGGAGGCTACGCAGGACTTTATCAC
CTTTCTGGACGCGCTGCGGCTCGGCCTGCTGGCAAAGGACCAGCTGCACCCACTGCTGACCGACGTGATCCATGCGGTCA
ACAAGGTGACGGACCGCGACTTTGAGAGCCGCGGCAAGATTGTCCAGTGGCTCATCACGCTCAACCAGATGAAGGCTACC
GACGTCTTGGCCGAGGATCAGGCCCGCGAGCTGGAGCTGGACATCAACTCGGCCTACCAGGGCTTCAAGAGCACCTTATC
ATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62