GenePrediction:GLEAN_6007 Details

Name: GLEAN_6007
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:555770..553895 (- strand)
Length: 1876
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:555770..555548 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_82:555488..555190 (- strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_82:555139..553895 (- strand)
Length: 1245
>GLEAN_6007 class=GenePrediction position=GCSC_82:555770..553895 (- strand)
ATGGCGTCTGCACTACCTCGTCTGCCGGTTTTTGAGGCCATTGCTCGACAGGAGCCCAATTCCACAGCGGTCGTCCACTC
TCTCTCCGGACGTCGCTTCCAGTATGGCGAGCTCTTGGGTGACATTCGGAAGACCCGAAACCGCCTAGTCGAAGCCTCGG
GAAAGTCCGACCTCAACGGAGAGCGCATTGCATTCATGGTCGAGAACAGCTACGACTACATCGGTAAGATAGACACTTGG
CACGTACTCGACTTACATCTCTCTGACCGACCTGCTTCTCAGTCACTCTGCTGGCCATCTTGGCCGCCCGCTCGATAGCC
GTTCCTCTTTCTCCTGCTTTCCCGGTTCCCGAGCTTCAGTACATTGTCGATCACAGCGAGGCAGCGCTGGTGCTCTCGTC
CGCCAAGTTCCAGCACAAAATCAAAGACCTCTTGGCCGTCGATCTGGTGTCCAAACCGACGTATGTAGATCTCGCAAAGC
ACCTCGGTGGTGCGCCTCACGAAGCTGTCGAGCTGGACGCCGAGCTGGACGCTGGAGGTGCTGGCATCATGCTGTACACA
TCGGGAACGACGAACCGACCGGTAAGCGGCAGTTGTGTGATGCGCAACGTATCGACCTGACATGGCAATAGAAAGGCGTG
CTGATCCCTGAGCGTGTGATGACTGCACAAGCGAGCTCCCTGACAAAGGCGTGGGAGTACAGCTCTTCGGATCACTTTCT
CCACGTTCTCCCCCTGCACCACATCCACGGCACCATCAACGCGCTGTACACGCCTCTCTTCACCGGCGGCTCCATTGAGT
TTCTCTTCCCGTTCAACGCCGATGCGGTATGGAACCGGTTTGCGGCACCTTTCCTGCCACGACAAGATGGAGCAACGGAC
TCTGCGTCAGAGCCGATAACTTTCTTCACCGTCGTGCCTACAGTGTATAGCCGACTGCTGGCCACGCACAAGGCCCTGTC
TCCGCAGATGCAAGCAGCCACGTGCAAGGCCATCTCGCCAGAGCACCTGCGCCTCAGTATCTCTGGATCAGCTGCCCTGC
CGTCGCCAGTCAAGAAGGCCTGGGAAGACCTCTCGCACGGAAGCGTGCTGCTCGAGCGGTTCGGCATGACCGAAGTCGGT
ATGGCGCTGTCATGCGGCCTCGAGAATGCGGATCGCGTCGACGGCAGCGTCGGATGGCCGCTGCCCTCTGTGGAGGCGCG
GCTGGTGGACGTCGATACCGGCAAGGTGATCGAGCCCGGCCAAGAGGTAGACCCGGAGACCGGCCGGGAGCGTGCTGGCG
AGATCCAGCTGCGGGGGCCTACCATATTTGCAGAGTACTGGCGCAACCCCAGCGCGACGAGCAGCGAGTTTGCCGCGGCA
GCCGAACCCGGTGGCAAGGCCTGGTTCAAGACCGGCGACGTGGCAGTGAGACGGCCGGTGGCTGGCGCCGGAGCTGCACG
CGAAACGAGGCCTTCACAAGACTGGACCGGCCGTGGTGACATGTACTTCATCCTGGGCCGGCGCAGCGCTGACATCATCA
AGTCCGGGGGCGAGAAGGTATCCGCACTGGAGGTGGAACGGGAATTGTTGTCGATCCCAGCTGTGGCAGAGGCAGCCGTA
GTTGCCGTGCCGTCGGGCAAATGGGGACAGAAAGTCGGTGCTGTCCTCGTGATGAGCGACGGCGAGAAGCCATGGACGGC
TATGGATATGCGACGCGCATTGAAAGGCCGACTGGTCAACTACAAGATTCCACAGCTACTGCGGCTGGTCGAGCAGATCC
CGCGCAACGCCATGGGCAAGATCAACAAGAAGCAGCTCGTAGCCCAGGTGTTTCAAGACGACTTCAGCGGCGACGAGGCA
GGACCTACAGTAGTGCCGTCACCCAAGGGACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62