GenePrediction:GLEAN_6008 Details

Name: GLEAN_6008
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:551883..550249 (- strand)
Length: 1635
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:551883..551622 (- strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_82:551521..551394 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_82:551331..551226 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_82:551039..550249 (- strand)
Length: 791
>GLEAN_6008 class=GenePrediction position=GCSC_82:551883..550249 (- strand)
ATGACAGACAAGCTCCCGCCTCAGCTTCTCGCGCTGTTTGCGCCGCGGCCACCTCTTCGATGGGTGCAGCCGGTCGACTA
CGCGCCTGGCGAACGACAGACCATCCCGGTGTCGGGCATTGCCCAGTTCCTGCCGGCGCTGAAGGAATTTAAGGACCACG
ATGGATTCGTTCCGACAGAGAGCTGGCTGCAGCGGCGCGAACGGAAAGCCGAAGAACACAAGGCCGCAGAAGAAAAAAAG
CTCACAGAGGGCCCTAGAAACTGTTCGTCTGCGTGTTCCTTTGCATTTCCACTGGTGGTCCCCCATCACTTGAACTGCCT
CTGGCCCATCTACAGTTCCTGATACTGACTTGCGCTTGCTAGACAAACCGGCCGACGACCCGAACATTCGCGGCGATCCT
TTCAAGACGTTGATCGTGGCGAGGTTGAGCTACGAGGCCACCGAGCAGGATCTCGAGCGCGAGTTTGCCCGTTACGGTCC
TATTGAGCGCGTACGTTGAGCTCTCTTCCCTTGCGCTGCGGTCGTGTGATGGCCATGACTGACACAGCCCAGATTCGGAT
CATCAAGGACACACACGCAGACGAAAAGGGGAACAAAAAGCGGAAACCACACCGAGGATACGCCTTTGTTGTTTTTGAGC
GCGAAAAAGATATGAGAGGTAAACCAAAGACCAGACTGGTGCCGTGACATGTCCCGCCGGCCTTCCTTCATCTACTCCAC
GACTTGTCATAGTCTTCCTTTCCGTCCTATCTGCAACCCCCCCTTCCCCGACCTTTGGACAGGTATGTCCTTGACATGGT
AAGGCAGTACTGACGAAGCGCCTTTTTCTGCGCGCAAAAAACAGCTGCCCACGATGCTTGTGATGGCATTCGCATCAAAG
ACCGGCGTATCAAGGTGGACGTGGAGCGCGGACGAACGGTGAAGGGCTGGAAGCCGCAGCGTCTGGGTGGTGGATTGGGT
GGTCGGGGATACACCAAGGCCGCGCCCTCGCAGCCGACAGGCCGCGGCGGAGGCGGGTTTGGCGGAGGTGTAGGTCCCGG
CTTCCGTCCAGGCGGCGACGGCTTCCGGGGCGGCGGCTTCCGGGGTGGCGGTTTCGGAGGCGGTCGCGACCGCAATGGTG
GAGGATCTCGAGGCGGCCGCGGCTTTGACCGTGGATTTCCTGGTGGTCCGCGTGGCGGTGATGTCAACGGATTCGGTGGA
CCGCCGCCGAATGCACCGGGTGGACCGGGCTATGGACGGAGCGACCGCGGCGGCGACCGTGGTGATCGTGGTGATCGTGG
TGATCGTGGCGATCGTGGCGATCGGAGAGATTTCAACGGTGGGCATGAGTCGCGTGACGGAGGACGCTCCTTTGAAGACA
AGTTTGCCGGCGGTGGCTTCCGCGACAACGACCGCGACCGCGACAGAGACCGAACGCGGGATAGAGACCACGATCGACGT
CGCGATCGGGGCGGCGATCGGAGCGACTCTCGTCGGACGGGCAGCAACATGGAGCCGATCCGACCAAGAGAGAATGGTGG
GTATCGTGACCACAGCAGCCGCGACTTTGACCGGCCGCGCGATGACGACTCGCGCAAGCGCGGATTCGAGGGGCCTGTCC
ACGACGAGACCAGAAAGCTGCGACGATACCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62