GenePrediction:GLEAN_6009 Details

Name: GLEAN_6009
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:534525..529171 (- strand)
Length: 5355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:534525..534342 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_82:534242..533628 (- strand)
Length: 615
Type: CDS
Source: GLEAN
Position: GCSC_82:533551..533318 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_82:533255..529288 (- strand)
Length: 3968
Type: CDS
Source: GLEAN
Position: GCSC_82:529230..529171 (- strand)
Length: 60
>GLEAN_6009 class=GenePrediction position=GCSC_82:534525..529171 (- strand)
ATGTCCGATGCCAGTACTCTCGAGGCGCTTCAAGCCTTTCATAGAGAGCTGATAGCTGTATCCGAGCACCGACTCGACAA
CCTTCAGCTTTTGGACCCGCTACTTGCTGCCCATGCGGACCGCTTCAAGAGCCTTGTCGACAAGGAGCCCCGGAAACAGG
AGAGTCGGAGAACCGTGGAGTCAGGTGAGAAGGCGACCCTCTCGGAAGAGCGCAACATGTTGATGTTGTCCCGTGGTTGC
CTTCCATTGGCTGGATTTATGTGCTGACCTTGCCGTCGAACAGGAAAAATTGTAGTTGGTGACGAAGAATACTCCGTCAA
CAAGGAATTTCAAGAAAGCATATTACAGCTCGCAGACGAACTAGACTTGGACGAGATACAAGCCGCTCAGCTACTCCTCG
ACTCCGAAGATGACGTGGTCACACTTGGCCGTCCGTTGCTGGAGTGTGGACTTATCCGGTTTCACCAGCAGCGCAAATTC
GTGCTCGATTGCATGCGCTTGTGCATCCTGTTGGCGGACGATCAAGACCTGGACCCGGCAGTACAGGCTATCTTTGGCGA
CTACGTGACCGAGAGTATATACGGAGCTGCTCTTCCGGAACAGCCAGCGCTGGGGCCAGAGAAACGTATTGTTCCTCGTT
GCATGATTGCGATGCAGGAAATACGTACATGGCTCCAGAAACTGACAGATCGCGCCACTGCCGCTTCCGTTCTTCAGGAG
CACCAGCCCGCGGAGGTCAAGGAAATGTTTGACTTTTCCCGGATGAGCCTAATACAGCAGCACGAAGGCCTTTCTATAGT
GCTACTTAGTGCGGTTGAGAAGCGACAAGCAGAGGCTCGAGACTTTGAAGACCTCCTAAAGCTCCTGCAAAGACTGGATC
GCTATGACTGCCTCCTACGTAGGTTTCGAGATCTGCTGCTCGTCTGCAATATATATTCAGACGCGTGATACATATATGCT
AACTTTTGTCACAGTCCATTTATTCCCCACTCTAGCCTGCTACATTCGCATATTCGGATCACCAGATGGCGTTTCTAACC
TGGCTCAGGCCCGAAGATTGAACGAGATTGTCAATCGCCGCGAAGATGACGGAGTATGGCAAATGCCATCATTGCGCGCC
GCCATCTGTGCTTGGTGGATAGCAGAGTACAGTGGGTGGTACATGGATGACATTGATGTCTCTCTCGATAATATCGATGT
GGACAAAGGTACTATTCATTAGAATTCCTTAGTCTGGTGTCGCTTGCTAATTTACTTCACTACGTACCAGAGGACAAGGA
GCGGGCGGACACATTCTCAGAGTGCTTAAAAGAGGGAGCCTTGGACTTCATTCTCGCCGTTTCCTCTGATGTTGAGATAA
GAGACTGGCAAGATCCAACACCAAGCGGTGTCCAAGTTTGGATTCAGCGAAAATGTCCGCCTCTGCCTACTGATTCTGTT
TCATTTGCCGACCATTTCCGAATCCGGGTCCTGGAACAGCTGGAGAATTTTGTTGATGCCTTCATTTCAAACCTCCCTGA
CGTGATCCGGCAACTGAGAATCGAGGAGGACGAGCAAAGACAGCTCAGCCAGATGCACGAACAAAGCCTAGAACTGGAGC
GGTTTCTTCTCATCATATCAAGCGCATACGAAGGCCGGCCAGAAGCAGCTGAGGCTTTCTGGGCGGACCCTGAAAGCAAC
TTGGCTGGTTTTATGCAATGGGCCAGCCATCGGGCGTCGACTCCACTGGTCAGCGCTTTCTGTGAGATGCTTCGGTCTAT
TTCTGGAAACGAGGCGTCTGCTGAGGCTGCCCACGATTTCCTTCTCGACGAGATTAATAGCTCATCAAACACCGGCCGGA
TACGGAAGTCTCAGTCCCTCACCTGGGTTCAGGTTGTCAAGGAGCTCGAATTCTTCACTGCTCGAATCCGGGCACATACC
AGCCCAGCCCCAGCTCTGACATACCGTGGTGGCAAGCCTAGCGATGATCAGGAAGAAGCAGAGCCGGAGTCAGCCATCAT
GTTGGAGTGCTACCTGCGGCTCATTGCCCGGATCTCGTCGAACAGCTATACTGCTCGGATGTGGCTACTGCAGAGCAAGG
ACTTTTCGCTGGTAGGCGTGCTCTTCCAGCTGGCAAGCTTGCCAGTACCAGGCCCCCTTCGAGCACGCATTTTCACGGCG
CTGAAGGCCCTGCTGTCCGAAAAGTCTCTCGAGATCAGCTATATCATGTGGAACTGTCTCGATGACTACATGTCCGGCGC
CTATGTTCAACACACTCAGCAGATGATGCCGGTGAACGCTCCGACTCCCAGCCATTACATGGAGGGATTTCTTTCCGAAC
TCACCCAAGGCTTCGAGCAGCCTTACGCGTTTGTTCAGTTTCTCCTAGCGCTTGTTGTTCCTGCAAGAGACCAATCGCCT
CTGAATGACGCTCTGCCTTTCCCAGAAAACTATGGAGCCGCGATGCGGATGCCTGGGATTGATCCTTACGTTGACTTTGT
GTTGAACACAGTGTTGGGGAAGCATATTAAGGAGTTGGAGAACAAACAACAGCAGCAAGCTCTGCGGCTTAGCTCTCTCG
ACTTTGCTCTAGCATGTTTGGAGACATTCAATGAGGATTTGCTTCTCATCGCAAACGAGACCGCGTTGCCTGTCGACAGT
GCCATTGCAACAACCGACCTGGCAGCGTACGTCAAGCTGCACCCATTTGCACGCGTCATGGAGTGGATGTACAGCCACAA
TGTTGTCGAGTCGATTTTCAAAGCCATCCCCGAAGATACGGCAGAGATCGGAGGTGCAGACCCGGATTCGCCGCTTATTC
TCGGCATCATTCGAGCGGTACAACTGGTCTCGAAGATTCTAGACCTGCAGGATACGTATCTTGATCTGGTACGACAGCTC
ATCCGACTTAAAGTGGGGGACCGGAGAAAGCCGGTCAGCTCAGCGTACAGCTTCTTTGAGGAGGCCATTTCAAATCGCCT
GGATGTCGTTGTTAATCTGGGAAGCTGCTGTGGTTTGGGGCACCCGACGTTGACGCTGGCTTGCTTGAAACTCCTCGAGA
AGGTATCTGTCTCGCCTAAGGTGATTTCTGCGTGGAACCCCGGTCCAGGACAGCATGCCCGCCGGAACAAGGCTATCGTG
GCGCTGGAGAAAGACGGCGAGGCGAGCGCGATTTCTGGTGCCTTTATCTCGGAGATGATTGCGCCTTTGGATCCCGGCCT
CGAAGCCGAGTCGCCAAATTACAGTATCAAGACCTTCATGCTGGATTTCCTCCACTCTTGTCTGCAGGCATCTCCCAACA
AGCCTACGATAGCTCACCTGATTCTTGGGTTTCGGTGTGGCATTGACGCCTTAAGTGTTGAATCTGGAGGTGCCTTTGAC
GACCGCACCTCGCTCTTCCATAACCTTCTCCGCGTGCTTCTGGAGGCACCGTTTGGGGACGATGAGCTCGGCATGCGTCA
CTGGCTGATTCTGCTGAAGCACAAGATAATGCGCATATTCCAAGTGCTATGGCGCTCGCCGCTATCGTCAGCCATCGTCT
TGTCCGACCTGCGGGAAAACGACTTTGCCTTCCATCTTCTCATCCGCGAGGTGACCTTGCAACAGGACCTGCCGTGGGAT
GGACTGTCCACCAACAGCCCTGAGTTCATCACAACGGACGCGTCAATAGGGTTTATCGAATTCTGGGCGGTCCGTGCGAT
GACGTTGGAGTACATTGGCATCGAACTGTGCAGCGTGTCGCAAAACCGGATGCCGAGCCTGAAGCGGCGAATCTTTGACG
CCTTGAACGGCCAGGTTGTGAATGACAGTGGCGAGCCGATTTCCACCCCGACCGTCTTCGAGCTCTACGACTTCATGTCC
AGCAACAGCAGCAGTACGCGGTGGGAAACGGCGCCGCCGCCTCTGAAATTCCTGCAGGACCTGGATCTGCGGGCATCCAT
GGACGAGACTCCCTACGGCGAAACGCTCTACGACTTGGACAAGGCGCGGGAACTTGCTCTGCTAAAGGCGGCAGAAATCA
TGAAGGAATCCCAGTTTGGCGAACGGGCATTCGAAGAGCTGAGAGAGGAGATGCAGCGTGAAGAGGTACTGATGCTGGAA
TATCTGTCTATCCTCAACCGACAGAAACAGCTGGCGAACAACCACCAAATCGTGTTGCAGTCGTGGGCAAAACTGCTTCT
GGTAATGTTCGAAGCCAACGAGTTCAGTGGCACAGCCCAGGTGTCATTTCTCCTCCAGGCCTTGCAAGCCATCCTGCCGG
GGCTGGAAGCCGCGAGCACCGAAAACCCGGTACAAGCATTCGAGCTGGCGAAGCTGGCGGAGGCGCTGCTCTTCAAACTG
GGCTCCCAGAAGAGCGGCAACAACGACTTCAACGCAAGCGAAATCAGGGAGGGCCGGCAGATGAGCAGCCTTGTGAGCGA
TAAGCTGTTCCAGCTGTTCCAGATCTGCCTGCATGCGGTGTGTAAATGGGTGGGCAGTCCCGAACTGCGGGCTGTGTATT
ATAACATATGCTACCGCCACGTGGCCGGGCTCATTGACAGCGGCAACCAGGGCGACGGCGACAATGCCGAGACATACCAG
CAGACCGGGATGCAGCGAGCCAGCAAGGCGGTGGACATGTGTGGCGAGCGGGTGCTCAATGTCATCTGCGACGACGCCTA
CAGCAGCGACTCGACCTGCCAGGCAGCCGCGCTGATCTTGTTGGGCTCGCTTGTGCGACTGGGCGAGCACGAGAAAGACA
CGCACGTGGTGGAGCTGCTGAACCGTCTGAATTTTATCGGCGTGCTTGTCGACTCGCTGCGGACGACGTTGCAAGACGGC
CTGGCGATCATCCAGTCGGGCAGCCTGGACCAGAAGATGTCGCAGGACGCCAAGCTGGCGCTGCTACTACAGCTGTGCCA
AACACGCGACGGTGCCAAGTTTGTGCTGCACGCGAACCTCTTCCGGGCGATCGAACTGAGCGGGCTGTTTGCGGCGGATC
CGGAACTGCAGGTCGACCCGGCCAACACGGCGGCGCTGACTCAGCACTACGAGCTGCTCGTCAAGACGGCACGGGTGGTC
GGTGCGGCCATCGTCAGCCGGGGCTCACACAACGTGCAGCAAGGACGGCGCTTTCTGGCAGAGCACCGCATGCTGGTGAT
GCACGTGCTGAAGCGATCAGCCGGCATCGGAGCAGTGTCCTCGCGGCTGCTAGATGAGATGGTTGAGGAGCTGGCCGAGG
CCTTCATGGTGCTGATTGTGGCGACAAATTTTTTGGAGGTGGGTTTACCTCCATCTGCGACTTCTCTGTTCTCTGCTAAC
CACTAACACTCGCAGTTTGAGGACCAGGCGCCCGTCCAGCCACAGAAGACCCCAGCACGGGTCGCGTTCCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62