GenePrediction:GLEAN_600 Details

Name: GLEAN_600
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:860218..862345 (+ strand)
Length: 2128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:860218..860325 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_97:860403..862226 (+ strand)
Length: 1824
Type: CDS
Source: GLEAN
Position: GCSC_97:862286..862345 (+ strand)
Length: 60
>GLEAN_600 class=GenePrediction position=GCSC_97:860218..862345 (+ strand)
ATGCTGCGGACTTCCATTCGATCTGCGCAGTCCCTGCGCAGCCGGACCCTGCTCGCGGCAGCAGCAGCTCCGGCAGCAGC
CGGGCGGACGGTCAGCATCAGCAGCAAGGTAGGAAGAGGGTGTGACAGGCGGCAATGGATGGGAGTGTTGCCGTGGATGG
TATGCTGACAGATGTGTGCGGGCAGCGATTGTATGCCACGGATCCCAAGGTCACGCCGGCCATTCATGCGACGACAACGA
CGACGGTGCCACCACCACCGGCAGCTACGATGGCAGCAGCAGCAGCGGTAGCGCCGCGCAAGGGCGGGTTCTTCCGGAAG
CTGCGCAACTACGTGCTGACGCTCTCGATCCTGGGAGCGCTCGGGTTTGGCGGCGGCGTGTGGTGCTCGCGGATTAACGA
CAACTTCCACGACTTTTTCACCGAGTACGTGCCGTACGGCGAGCAGGCGGTGCTATACCTAGAGGAGCTAGAGTTCCAGA
AGCGGGTGCCGACGATGGCGCAACGCCTGGGCGGACAGCAGCCGCGGGACACGGGGTCCAATGTGCGGGTGCCGGCACAG
AGCGGAGCATCGTGGCGGGTGGCGGATTCGGAGAGCAGCCGGCAAACGGGCTCGACGGCGGCGGTGGCAGCAGCAGCACC
AGCACCAGCAGCAGCGCCATCGACCAAGGCGGAGGCCCGGGTAATCTCAGTGAAGCCGGCCAAGGACGAGGACGTGATTG
CGAACGTGCTGGCGAAGCAGGCGGCGAGCAAGACAGCAGCGGCAGCCGAGGCAGCAGTGGTGCGGAGCACGGACAAGGCC
AAGGCCAAGAAGACGACGACATTGGGATACCGGGCGCCAGAGGTGGACGAGCCATCGCGGTGGCCGCCGGCATCGCCAAT
CGACCCGCTAGCGGTCCGGGACGCGACGGAGCCGGTGGTGCAGGACATTGTGCACGTGCTGAACGACATCATCACGGTGA
TCAATGCAGATCGGGCGGCCGATCGGTACGGGGCAACGATCGGCAAGGCCAAGGCGGAGGTAGACCGGATCGGGGGCAAG
ATCCAAGCGATCCGGGCAGGTGCAGAGCAGGCAGCAGCTCAACAGGTGCGGGCGCGGACGGACGGTTTTGAAAAGGCGGC
GCGCGAGCTCGTCAGCCGTGTGGAGAGAGCCATGGTCGCTCAGGAGGCGCAGTGGCGGCAGACGGTGGACGTGGAGCTGG
CGCGGGTTCGGGGCAGCTACGAGGAGCGGCTGGCGCTAGCAACAGCGCGCGAGCGACAGCTCAGCGAGGAGCGGCTGCAG
AACGAGCTGCTGGAGCAGGCGGTACAGCTGACGGGGCAGTTTGCCGAGGAGCTACGGACGCGGGTCGAGGCCGAGCGGGA
CGGCCGGCTGGGACGTCTGCGGGCGCTGTCGGACGACGTGGCCGGTCTCGAGCGCCTGACGGCCGGCTGGACGGCCGTGG
TCGATGCTAGCGAGCGGGCGCAGCAGCTGCACGTCGCCGTCGACGCCGTCCGGGCCCGTCTTTCTGATGAGTCAGCAACC
AAAGCCACAACGGAGCCGTTTGTGCGCGAGCTCGTGGCCGTCAAGGAGATTGCCGGCGGCGACGCCGCGGTGGATGCGGC
CATTGCGTCGATCCCGCCGGCCGCATACCAGCGTGGCATTCCGTCGGCGCCGGCCATCATCGACCGGTTCCGTCGTGTCG
CTGCCGAGGTCCGCAAGGCCGCCCTCCTGCCCGAGGACGCCGGCGTGGCCAGCCACGCGTCCAGCTACATCCTCAGCAAG
GTGCTCTTCAAGCGGCAGCCAGCCGTGGCGCCGCAGCCTGTGCCGTCCGCCACGACGGCGGCCGGTGGCGGTACCCCCAC
CGCCGACGACGTCGAGGGCATCCTCGCCCGCACCCAGGCGCTGCTCGAGGAGGGCAACCTCGACGGGGCGGCGCGCGAGG
TCAACGGGCTCCAGGGCTGGGCCAAGACGCTCAGCCGCGACTGGCTGGCCGAGGTGCGCAAGGTGCTGGAGGTGCAGCAG
GCCGTCGATGTGAGTTTTGTATTCGTGTTTGTGCTGCCGTGGGGAATGTATGTGTGCTGACTAATCAGGTCATCTCTGCC
GAGGCGCGGCTGCGCAGTCTCCAGCTCGAAAAGAGCCATGCAAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62