GenePrediction:GLEAN_6010 Details

Name: GLEAN_6010
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:526134..522553 (- strand)
Length: 3582
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:526134..525978 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_82:525902..522553 (- strand)
Length: 3350
>GLEAN_6010 class=GenePrediction position=GCSC_82:526134..522553 (- strand)
ATGTTCCGGCCATTGGCCGGCCATGGCCGAAGCCAGAGTTCTGCAGCTGCAGGCTTTGCGCGGATGGCCTGGCATCGCAG
ACAAACACCGCGACGGCCATGGTCTTTTGCAGTCCGGTGGGCATCTGCCCTGACGGACGCAAAGACCACTCTTGCCTGTA
GGTGGGAAGATATTGGGGCTAAGCGAGCAATGAAGCTTGGAGGGCGCGAGAGCTGACAGTCCATTTTCTCAGTGCCGTCC
GAGGCGCGTTACAACGCGATCGGAGTCCAGCAGGTCAGCAACCATATCTACGATCAGATCTTTCCTGGTGGCAGCAATCC
CCCGTCTGAAGAGCTGGTCAAGCTGGCCGAGGACCACCTCCGTCGCCACGATCTGTTGGGCAAGAACACCGGCATCACAG
ATCCTATCGCCTTCGATCTCCCTCCTCTGCAGGGCGACTCGCTCGACGAGCACTTTTACAGGCTTGGCGTAGACGCTGCC
GAGCCCTTTCTCAGCTTGGCGAAGCAGTTTTCTCGCGCAAACGCCCCCCCGCTTCCGCGACGGTGGGAGCGGCAAAGCGG
GTGGACCAAGTACTACCAGGACGGCCGGACCGAGGCCGTAGCATGCCCAGAGGAGGCGATGCTCGTGTTTGACACCGAAG
TCTTGTGGAAAGAAAGCCCATTTGCGGTCATGGCCTGTGCCGCAAGCCCGACGGCTTGGTATGCCTGGCTGTCGCCATGG
CTGCTGGGAGAGTCGGACAACGACTGCCAGCTGATTCCGCTGGGCGACCCGGCTGCAGACCGGATTGTCGTCGGCCACAA
CATCGGCTACGACCGTGCCCGGGTCCTGGAGGAATACGACCTGCGACAGTCCCGCAACGCCTTTCTGGACACCATGTCCC
TGCATGTTGCCGTCAATGGCATGTGTTCGCAGCAACGGCCGACGTGGATGAAGCACAAGAAGAACCGCGAGCTGCGCGAT
CGCGTCGCCCAGGACACTGACAACTTTGAGCTGTCACAGCTGCTGCAGAACAGTGCGCTGACGGCCGAGGAGGAGGAGTT
ATGGGTCGGCCGAAGCTCTGTCAATTCGCTGCGTGATGTCGCCAAATTCCACCTCGACGTCGCCATCGACAAGTCCGTTC
GGGATGAGTTTGGCGTGCTGGACCGGACTGGGGTCCTCGACAAGCTCGATTCCCTGCTGTACTACTGTGCTGCTGACGTC
GCCGTGACGCACCGCGTCTTTCAGATCGTCTTTCCCAACTTCCTCGACGTGTGCCCTCACCCGGTCAGTTTTGCTGCCCT
TCGCCATCTCTCGTCCGTCATCCTCCCCGTGAACAAATCTTGGGAAACGTACATTGCGAATGCCGAGGCCACGTACCTCC
AGCTGTCTGATGCCGTTCAAGGCCGGCTAATTTCTCTGGCAAATGAGGCGCTTGAGATCCTAGACGACCAGGACAAATGG
AGCCAAGACCCTTGGATGCAGCAGTTGGATTGGTCCGTACAGCCCGTCAGGATGGTGAAGGGCAAGCGGAAGGGGGAAGC
CGATCGCCCTGCCCTTAACCAGAAGATGCCCGGAAAGCCAACGTGGTACAAAGGCCTCTTTCCCTCGGCAAACGCGGAAA
TAAATTTGACCGTTCGGACACGCATTGCCCCGATCCTTCTGCGCCTATCCTGGGACGGACGCCCGCTCGTCTGGTCTGAC
AAGCATGGTTGGACATTCCGGGTCCCGGTGAGCGAAGCAGTGCACTACGACCAGAAGCAGATGGCCCGGTGCGACATGGA
AGACGAAAAGATTGAGCTGCTCAAGAATGACGTTCACCATGTCTACTTCAAATTGCCCCACAAAGACGGGCCCACAGCAC
GATGTGTCAATCCCATGGCCAAGAGCTACCTGTCATACTTCGAACAGGGCCTTCTCTCGTCCGAGTTCGCCTACGCTAAG
GAAGCGCTGGAGATGAACGCCTCGTGTTCTTACTGGATGAGCGCCCGTGATCGCATCAAGTCGCAGCTGGTTGTTTACAA
CGGACAGCTGTCGGAAGCAAGCGAGGAAAGCAAGGCCGACGATGATGAGTCAGCAGTGCGGGACCAAGGATTTATCTTGC
CGCAGGTCATTCCCATGGGCACAGTAACACGTCGTGCTGTGGAAAATACATGGCTGACAGCCAGCAATGCGAAGAAGAAC
CGGGTTGGCTCAGAGCTCAAGGCCATGGTGAAGGCACCGCCGGGCTACTCATTTGTCGGCGCCGATGTGGACTCGGAAGA
GCTGTGGATCGCCTCTGTCGTTGGCGATGCCACCTTTGGTCTGCACGGCGGCAACGCCATCGGATTCATGACGCTAGAGG
GAACCAAGGCTGCCGGGACAGATCTGCACTCCCGCACAGCCAGCATTCTTGGCATCACGCGCAACGACGCCAAGGTGTTC
AACTACGGGCGGATCTATGGAGCAGGTCTCCGCTTTGCGGCGCAGCTTCTGCGCCAATTCAATCCGTCTCTGTCCGAGGC
AGAGACCGTATCGATCGCGACAAAACTGTATCTGGCCACAAAGGGAACTCGCACAAACCGCAAGGCGCTGTGCAAGCGGC
CATTCTGGCGCGGCGGCACCGAATCGTTTGTCTTCAACCGCCTGGAGGAGTTTGCCGAGCAGGAACGCCCGCGGACTCCT
GTTCTGGGTGCAGGCATCACGGAGGCGTTGATGGGCCGCTTCATCAGCAAAGGTGGCTACCTGACATCGCGCATCAACTG
GGCCATCCAATCGTCCGGCCAGGACTACCTCCATCTCCTGATCGTGGCCATGGACTACCTGATCCGGCGCTTTAAAATTG
ACGCTCGTCTGGCCATTACTGTGCACGACGAGATTCGCTATCTGGTAGGCAACCACGACAAATACCGCACTGCCATGGCC
CTCCAGGTGGCCAACGTTTGGACGCGTGCGATGTTTTCCGAGCAGGTGGGCATCCGCGACCTGCCGCAGTCGTGTGCCTT
CTTCTCGGCGGTTGATATCGATCACGTCCTGCGCAAAGAGGTCGACATGGACTGCGTAACGCCCAGCCACAAGGAGAAAA
TCCCGCACGGCGAGAGCATCGACCTGCCGACCTTACTCGCGCATGGTGACAAGGCCCGGCTGGATCCAGACATTGAACCG
GCAGCTGGCCGCGCGCCCAAGCTCCACCACTTTCCGTACACGCCGCGCAAGCCGGTCATGGAGTCGCTGCGTGAACTCGA
CGGTGGTGCCGATCATCTGGCCTTTATCCGTGCACAGATCACCGCAGATGACAAGGAGTTGAAGGAAATTATGACGTCGA
CGCGGAAGCCGGTTTCGACAGCCTCGCCATCGGCAGCCAAGACCTCGCCGACAACGCGACGCCCACGGAAGCCCATCCTT
CCCTATCACACCAGCGCTCACCTGATACCGATGGGAGAGTCGGTGGCCGTGACGGAGTCTTTCGCCCGCAGTCGTTCCGG
ACGCCGAGCATCGGGCCATAGTTACTCTCAGGTAGTCGACAGCAGCGCTGATTTCGACCAATTTTGGGCTGCTGCGGGTG
ACAGCGGTCACAGTGGCAGGTTTGGCGGAAAACCCGGCAGTGGTACCTCGTCACGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62