GenePrediction:GLEAN_6011 Details

Name: GLEAN_6011
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:519694..517253 (- strand)
Length: 2442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:519694..519428 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_82:519293..518193 (- strand)
Length: 1101
Type: CDS
Source: GLEAN
Position: GCSC_82:518125..517845 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_82:517772..517253 (- strand)
Length: 520
>GLEAN_6011 class=GenePrediction position=GCSC_82:519694..517253 (- strand)
ATGAACACACTACAGACGGACGGCATGATCGGCGTGCATGCCGGTGAGGCTGTCACATCTGTGCCCATTCTCGATAACAC
TATGCCCGTCCTTTGTGACCCTGGAGCTGTGCCGCTCTCGAGCGACGCTTCGCTGGAGAGGCCAAACTATGACGAAACCG
AGCCGCTGCCAAAAAAGAGCCCGAGTGAAACCTCGGCGATGACAGCCAACAGCCAAGCGCTGCCATTGGCACCTTTTTCG
ACCGTATCGACCGCTTGCCTTGGTTGTGTAAGTTCTTTTCTGCCATCTGGCCTGCTTTTTGCTATTTCGCTTCGTGCCAG
CTCTCTCTGCTTTGTGTTGTCGCGACTTCGTCGACGCCCGGCCCCCGCCTGGCTTGGCCATGCTAACAGAATATCTTGCA
GCGAGGAAAACATCTGAAATGCGACGGCCGCGTGCCCTGCTCGCGATGCCAGCTTGCGGATATCGATTGCGTCTACATAG
CCTCCCGCCGTGGCTACAAGGGCCCGCGAAAGCCGAACAAGCGTCTCCGATCGTCGTCTTCGTCTCCGCCACCGCCATCT
GTGGTGCAGTCCAGCGTTACGGTCACGCCCGACAGCTGCCCAATGCTGCTGGGTGCTCCTCGCGCCGTGGTGTCGACAGT
GGCGCCTCTGCCGGGGTCGATGGCCGTACCCATGACCGTACCCATGACCGTGCCGACCACATCGTATGCGTTGCCCAGAG
TTGTCTCCGACCATGCGATGACGACCTTTGGCTCCATGCCGCCGGGCTACACCACAGCGTCCACACTTGCTGGGCCAGGC
ATGGCCATGGTTGCTTCCACCCCCGCCCCACTGGGGACCGCTCCGGCAGCAATGTCGCACATGAACCTATACAGGAACCC
CTTTTCCAACGGCCTGGACGGCGCCAACTATGACGTCGGAGGAAATATGGCCCTCTCGTTTGCAGCACCTCCGGTTCGCT
CGCTTGATGACCGTTGCTTCGATGCGTTTTACCACTTCTTCTTTGGCGGCCATCCGTTTGTGTTGCCCAAAGGGATGATG
ATGACGGTCGTGAGGGAAAACACATCGAATATGGCTCATCTGATTGCAGCCATGCGATACATCGGGTCGCTTTACATTGA
TGCCGGACCGGCACGCGCGCGGTTCTTCGACGAGGCCATCCGTCTGGCGTATCTTTCGACATGTCCCCAGGATGGCTTCT
TGGTGCAGACTTTGCTCATGCTGATTGTCGGACTGGACGGCAACTGCGAGCAGGAGCGGGCGCGCCAGCTCCTCGCTGAC
TGCGAGCGGATCGCGGTGGACATCAAACTGAATCACCGCAGCTTCGCCTCTACCAACGGTCGAGGGAACCCGGTCCTTGA
AGAGAGCTGGCGGCGGACCTGGTGGGATCTATTCGTGGTGGACGGCATGGTGGCCGGCGTCCACCGGATGACCAACTTCA
ATTTGTTCGATATTCCTACGGACGTTGCGCTTCCATGCGAAGAGGAGCAGTATCTCTCGGGGGTAAGTGTAGATTGGCCG
TTATGTATTGCAACGTGACGGAAGATCGGGGCTGATCGCTCTTTTGAAGAACATCCCGACGCCGGCTTATATCGAAGACT
TTGACGACCAGATCTTTACTGGCGAAGACCGCGAGTTCTCATCGTTTGCATACCGGATCGCAGCGGGACGCATCCTCGGT
CGGTTCATGCGATGTTCGCCAATCCATTATGCGCATGACGAGAACTTGGAAAAGATCCAATCGCTCCTTAGCAACTGGCG
GATGCACTTGCCGGCCAGCAAGCGAGACAACCTGACTAAGACGTGCCAGCTGGACGAGATGATGTTCCAGGCGCATTTCA
TGACGCATGCGTAAGTGTCGGAGCAAGCATAAGGAGAAGGAGACGGAGATGCAAGGTGGTGTTGACTAACATGGCCCGAC
AGCTGTTCCATCATGCTGCACCAGCCGCACTCGCAGCTGGACTCGTCGCCGACACGCAGCGTCACGTCGTGTGCGCCGCA
CAGCCATGTCCCAAGCGGGGATGCATTCAACACGCACACAAAGCACACCATCACAGCGGCATGCGAGATCAGCAAGATGG
TGACGCAGGCAGTGCCGCTGCTATCGCATACACACTTCTTCACGTGTGTGATCACGCTGTCGTCGATTGTGCATCTGAGC
AAGTGGGCGCTATATTTTATCCAGGACGAGGAGGACCTGCGGCAGCAGATCCGGCTCAATATCGGGGCACTCAGCAAGCT
CAGCGAGGTGTGGAGGGCGGCCAACACGGCGGGGGGACAGGTCAAGGGCGTGGCCCAGGAGATCTACCGGGCGAAGAAGG
CGCAACAGATCAACCCGGCCTTCTGGGTGGGCTTCACGCAGGAAGAGATGATTAGCAGCATCAACGCAGACGAGAGCATC
ATGAGCGAGTTCGACAATATGCTGCCGGTGGCGACGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62