GenePrediction:GLEAN_6012 Details

Name: GLEAN_6012
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:514163..512659 (- strand)
Length: 1505
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:514163..514126 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_82:514070..513904 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_82:513839..512659 (- strand)
Length: 1181
>GLEAN_6012 class=GenePrediction position=GCSC_82:514163..512659 (- strand)
ATGGCTGTGAGGCCGGGCGAAGAGAACGTCGCGACGCTGTACGGTCATATACCGCTCCGTTTCCTGTGCAGCAGCAGCTG
ACTTCTAATCCAGCTTTGGCGACATCCACTACTTTTACGGCCCCGAAACCGACAACCCACCACACCACCGCTTTGACAAG
GGCTCCTATGTCTACCTCTTCGAGAACGCCGTCGAGGGTCGCACGCGCATCGAGGTTGCCAACCGGCCGGGCACCGAGCT
CCAGGACGCCTTTGATGGATGTAAGCACCATACAGAACCATTTTACGGCCTTGTTTCTTACTTTCTCGCCGCTTACAACC
ACAGATCTCGACTGCACGGCCGTCAGCTACTCCTACAGACACAGCTGTATGGTCTCTCTGACCGTGCATGACGTGCCCAA
TCAGGAAGAATGGCACCTGCCCACATACGACCCCCAGAACCAGAACATCTACCACTACAAGCTGCACAGCCTGGACATCT
ACTTTTGGACCCCACGCGACGCCCTCCAGTTTGTCAATGGCGTCCGCCGTCTGCTGCCTGCCAGCCAGCTGGACATTGAG
GACGAGCCGCTGCCACCCCCGCCGCCACCATTGCAGCAACAGCAGCAGCACTACGGAGCCGTGCCTCTGGACGTGAGCGT
GTCGCCGGTGGTGCAGAAGCTCGAGAGTGTGGCTCTCTCGGAAGGCAGTGTCGCGACAGCTGCGCCGGCAGCAGCAGCGA
TGTCCTCTTTTGCGGCCCCACCGCTGTCAGCCATCTCTGCAGACTCGGGTGGCAGCCGTCCCTCGCAGGGCAGCACGCCA
GCACCAGCACCAGCACCAGCATTCGTGCCTATGGCCTACAATCCAGCTGCACCAGCTGCACCTGAGACGATCCGACCGCG
TGAAAAGACGCCACCGCCCGAAGACGCCGTTCCACACAACCCGCTGCACCAGACGCTCGTGCAGGACGCTTCGACGCCCT
TCAGCCCGGGACTCGTCGTGCCCATGGGCCTCGGCCCGCTCAGTCCCGGCGTGCCTCCACCAGCCTTTGCCGCACCACCT
GGCGCTCCGGCCTTTCCGGCCTTTCCAGGTCCCCCTCCCAACTTTTCTCCCGGCTCGACACCTGTCACGGCTGCTGCTGG
GGCCGGAACTCCCCACCCTGGCCACCCCGGCCTCGTGCGCGCGGGTACTATGCCGGCCTCGCCCTTTAGCCCCAATGGCT
TTCCTGGAGGCCCTTCTTTCGCGGCGCCGACGACGACGAACCAGTACCAACACACACCGACGCCGCCACCTGGCTCGGCC
GCAGCCCTCGGCGGTTACAGCCAATACAGCTATAGCACATCGTCGACGACGCTGCCGGCAGCAGGCGAATACTCGGTCCA
CCACCAGCTGTACCAGCCAACCGGAGGGGAGGCAGTTTCGCACCAGCCAAAGCAAGATCCGCGTGGCCGCTTCGAGGAGA
ATGCCGGGCGGATCGAGCGCGGCGTGTCAGGCATGTTGAAGAAATTGGAAAAGAAGTTTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62