GenePrediction:GLEAN_6013 Details

Name: GLEAN_6013
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:511430..508708 (- strand)
Length: 2723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:511430..511305 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_82:511248..510005 (- strand)
Length: 1244
Type: CDS
Source: GLEAN
Position: GCSC_82:509569..508708 (- strand)
Length: 862
>GLEAN_6013 class=GenePrediction position=GCSC_82:511430..508708 (- strand)
ATGTACATTCGCAAGGACATGTCCGGCAGTGCGCCGCTTAACTTTCGGGTGGCGAGAGCCATACGGGAGATCCAGCCGCC
TGACAAGGAAGATCCTCAACCCAGCAAAAATCACTCGGTCGGCATTGTAAGCAACATCACAGCCACCTCTTGACCAATGC
TGACGTTCCTTGACCGAAACAGATTCTTGGCTGCATCTTTGCTAGCTGCGTCGTCGCCGGCTTCCTGGTCATAGGATATC
TACGCTGGCGACGACTGCGGAAGCCGCAGTATGCACTCTCTGGCCGCGATGACAATGACCACAGTGCTACGGCCATACCT
GCTGTGACGACACAGACCACCACCGTTCAGACGCCGGCCGCGACAGTCGACCGGAATACGAGCGTACGGTCGGTCATGAC
TTTGCCGCCCTACCGCCCTAAAGCGTCCGATAACGAGCACGTTTTGGGCCGCGAGGGCGAGCGCGGAGGCATCGACGTCG
TCTTGGAGCTGCCGACGGCCGAAGAGGAGGAGTCTCTGCGTGAGGAGGAAATGGACACACTATTCCAGATCCGCCAGGCC
CGACGCCGTCAGGCAGCCGAACGGGAAGAGCGCCGACGAGCACGACAGGAAGCACGCGACCGGAACGACCGGGCAGCCCT
CCAGAGTATCCGGCAACAGACACAGCTGGCGACGACAAACAATTCTAGTGAGATCGACACGCTGCGTGCCGAGCTTGAGC
GTTCCCGGGACATACGGACTCGTGCGGTCAGCAAGGTGAATTACGCCGATGTGGGCGTGGCACGCCACGACGGCACGCGC
ATTCGGGCCAACAGCTCGGAGAGCGAACGTGTCGGCCTGCTCAGCGACGCGGCCAGCATCGGTGCGTCTAACCGTTCGTC
GGGCCTGCAGCAGAGCCTCCCTGCGACGCAACCTCATCACCGTGATCACAGCGCCAGTTCTGTGATCAGCCTCGACACCA
CGCACAGCGACGGTGTGCAATCCCATGGGCCTCCTTCGGCACGATCGCGCACGAGCTCCATCGGCCAGCATACGCGGGCT
GGGTCGAGCCCGGAGCTTATTGACGCTGCCGAGGCCGATATGGGCGACAGTTACATGCCATCGCACTCTCCGCCTGGCTA
TGACGAGGTTTCCCTCAACGACCTCACACCCGCCCACTCTCGCTCTACGAGCCCGTATCCCGAGCCGCCACCAGACTATA
CTCCGAGCACGATAAGCGGTCAAAACCCAGGGACCGTTGCTGCCGAGTCTTCTGGGGCGGCTGCCCGCACAACAGAACCA
GAGTCCTCGGGGAGCATCAGCAGAAGCGGCAGTGACAGAGATTCGAGAAGCGCCGCTATTGCACGGCTGCCAAGTTTACG
TCTGCCCGAGCTTCCACAAATTGTTATTGAACCGTCGAGTGCGGTGACGAGAGACGACAGCGAGCGGTGATTGCCTGACA
GCCATCTCCGACGGATATCGCCCGACCTGCGGGCAAACATAAAATGAGAGACGATGATGATTGTTTCGTTTTCAATTTCC
CTCTCCTTTCTCCTTTGGATACTTGGATCAGCTGGTTTAGTATGGCGTTTGGCTTGCAAGACGTACATTGATTTATTCTT
TGGAGACATTTGCCTTGCATTTTTCCTTCTTGCCGTGTTCCTGCATTCGAAGCGACGATCATTTGTAGCCTTACAGAAAA
TGTGTATATAGCCATGATTAATACCGAGACCTGAGACATATTGTTACTGCGTGCGCACATGTTTCGAGGGCCAACTTGTG
TAAGCGTCTATTACTAAATTAGGCGGGGTTGATCGCTTAGGTTTTTCTTATTTTTGCTCTCCATTACACACAGTGCAGGC
TAACTCTACGAGCGTTGTCAGCGCTGGCCAGACGATGCATCAACGTCCGCCGGTCGACCTGTACGACAGAGACGACCTCT
TGCCTGCAAACATGGGGCAGCCGGCGGCGGGAGGAGGAGGATATCACGGGACCGAGGAGGAGATGAGCGCGGCAGAGCAG
AATGGCATCGACCTGCTGGACGATGTGTTTGGATCGGGGGAAGCGGAGGAGGCCGAGAGGGTCAGAACGGCGACAGCAGC
CACGGACCATCCGTCGGACATGACGCGGCTGCAGCAGGAGCACTCGACGGCAGGCTACCGCGACGGTGTGACGGCGGGCA
AAGAGGCGAGCTCGCAGGGCGGCTTTGACGAGGGCTACTCGCTGGGCGCGGCACTGGGGCTGGCAGCCGGGGAGCTGCTG
GGGCTTCTGGAGGGGATGGCAGGAGGAGTGGTGGGGGCAGCGGCGACGGCTGAAGCTGCCACGGAGGACGAGTGTGTGTG
CCTGTTGGCTAGAGCGCGAGAAGAGCTGAAGCTGCAGTCCATCTACGGGTCGGCCTACTTTGCGCCGGACGGGACCTGGA
CATACGAGTTGACTGCGACTGAGAAAGAGGCGACTGTCTTTGATGTGGCACGCGCTCACCCGCTGGTCCGCAGGTGGCGG
CAGCTCGTGGACGCGCAGGCCGAGCAGCTGGGCGTCGTGCTGGGCGACGACGATGCGGCCGTGAAGGCGGCGCTGGGACT
CGGCGACGAGGACGAGGACGAGGGGAACGAAGAGGATGAGGGAACGACTGTGGCAACGGCAACGGCAACGGCAACGGCAA
CGGCAACGGCAACGGCAGTGGCAGTGGCAGTGGCAGTGGCACCGCGCAACGTGCCGGCCTCGAACTCGTCGCTGGACTGG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62