GenePrediction:GLEAN_6015 Details

Name: GLEAN_6015
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:484070..482934 (- strand)
Length: 1137
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:484070..484057 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_82:484002..483913 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_82:483856..483549 (- strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_82:483454..483366 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_82:483313..483209 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_82:483152..482934 (- strand)
Length: 219
>GLEAN_6015 class=GenePrediction position=GCSC_82:484070..482934 (- strand)
ATGGCTAATTCCAAGTGAGACTCCTTCGCTTTCGACTTTACCGGCGAATTGAGATTAAAATGTTCTAGATATGAGTACGT
CCGATTATTCGAGCAGTCGGATACACTGCTGCCAAACACATGGATTGTCGTCCGCATCGACGGTCGGGGCTTTACCAAGT
CTGTCATCCGATCTGCCAAATCGCCCACTCCGTCCTTATATGCTGACTGTACAGGCTGTGCGCCAAGTTTGGCTTCGAGA
AGCCGAATGACAAGCGTGCTCTTGACCTCATGAACGCTGCTGCGAAGGCTGTGATGAGCGACCTTCCCGACATCTCACTT
GCCTACGGTGTCAGCGACGAGTACAGCTTTGTTTTCCACAAAGCATGTCAGCTTTTCGAACGGCGTAGCAGCAAGCTAGT
GTCGACAGTGGTTTCGACGTTTACGGCATTTTATGTGCACCTGTGGCCAACCTTCTTCCCGGAGACGCCACTGACATCGT
CACCTATGCCGACGTTTGACGGTCGTGCAGTCTGCTACCCAAGTGTGCAAAATCTGCGCGACTACCTGAGCTGGCGTCAG
GTTGACTGTGGGCCATTCCGATTCCGTAGTGCATGCATTCTCAACTAACAATCCAGGCCATATCAACAATCTGTACAACA
CAACGTTCTGGGCATTGGTACAAAAGGGCGGCATGGACAGCGTCGCAGCAACTGATCTGCTGAAGGTAGGCTTTTTGGCA
TGCTGCCGGAGACTTTCCAAGATACTGACGGGTTCAGGGCACTTTCTCGGCAGACAAAAATGAGATGCTGTTTTCGAAGT
TCCACATGAACTACAACAACGAGCCTGATATGTTCAAAAAGGGCAGCGTTGTGTTCCGAGACGTGAGTGCCGAGACTTTA
TGCGTGTGGTATTGTAGAGCACATGTTGATGAAATTAGTATGAGCTCGTCGACCCAAAAGGCTACAACGCGGCTGAAGTA
GCTGATAGCCAGGCTGAGCCACCAACGCTCTCCAAGTCCAAGGAGGAGAGCGACAAGAAACGGCGTGCCAAAGCTCGGAT
CACGGCGGAGCACTTAGACATTATCAAAGACGACTTTTGGGACCGCCGGCCATGGCTACTTACAGGGCAGCCAGGTACCC
TCCCAAAGCAGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62