GenePrediction:GLEAN_6016 Details

Name: GLEAN_6016
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:477258..476730 (- strand)
Length: 529
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:477258..477220 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_82:477157..477075 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_82:477021..476730 (- strand)
Length: 292
>GLEAN_6016 class=GenePrediction position=GCSC_82:477258..476730 (- strand)
ATGACGATACGAGCACTGTCACAGGTCTCCGTCGCCCGAGTAAGATATATTGTGCCTTTAGAAACCTAACTTGTATGACG
CAACGCGCTGACGTCACACAGAATGGCGTCGGTGCCTTCATCCTGCAGTGCAAGAAACTCGATTTCCACTACTGTGACTG
GGCCGGCAGTTCCCGCGGCATGAAGTGAGTGCCAACGGCAGGCGCTTTCCAGTCTCGGCTTTTCTGACATTCACCAGCTC
GTTCATCAAGACCAAGCTCTCCAAGTTCGCAGCACAGAATCCTGAAGTCGAGTTCACTGTGTCGCCTCGGCCGTCGCGGC
ACCCCGTCATCGTCGGCCACTACATCAACGGCAAGGAGCGGGCGATCTGCGTGCGTAACATGGACCCCAACCAGATTCTC
AAAAAGGCCGAGCTGCTGCGAGACGCAACGGGCGAGGTGAACAAGAAGTTCAGCAAGCCGGTGACCAGCACCAACCAGAG
TGTGCGTGGCGTGTGGAGTCCATACCACGGCTTCGGCATGCAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62