GenePrediction:GLEAN_6017 Details

Name: GLEAN_6017
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:474189..472377 (- strand)
Length: 1813
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:474189..474027 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_82:473801..473539 (- strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_82:473472..473305 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_82:473024..472615 (- strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_82:472458..472377 (- strand)
Length: 82
>GLEAN_6017 class=GenePrediction position=GCSC_82:474189..472377 (- strand)
ATGGATGTCTATTTCACCACATTTTGGCGATTCTTGCCTTCCATTCTCGAGGAGATCTCCGACGCCGAGTATGTTGCCAT
TGACTTTGAGATGACTGGCATCAAGCTTCGGACTGCAGACAAGCATTACAGAGCTACTACTCAAGAGGAAATATACCAGC
AAAGTAGAGAAGCGGCTCATACCTTTCAGGCCATCCAGTTTGGAATCACTTGCCTTCATTACAGCGCGGACCAAGGTTGC
CATCACCTGCCACCAGTGCTTCACGTAGGGTTTGCATAGATTCGCACTCCTTACTAACTAGAGAGTGTAGATGCGTATAT
TGCGTCCTCTTACACCTTCCACATCTCTCCCATGTTTCCAAACGACACTGTTGGTAATATTCTTGCAGGAATGGTCGACC
GCTTGCTGGTGGTCTCTTATTCCTCACTCCTTTTCTTGAAGTACAACGGAAATCGGCTGGAGGATTCATATTTTGATGGC
ATCCCCTATCTCAGCCGCGAGGACGAAACGAATACCAGTAATGCGTTCCTCTGTATGGACAAAGACCCTAGCAGAGACGA
TATCGATCTTGAGATTCAAGATGAAGAAACCAAAGCTTTCTATAACGAAACTAAAAGGCTTGTCAGACTCTGGGACGAGG
ACCCCGAAGGCGTAAGAGAAGACCAATTGCTCTTCCCACGTTGTACTAGACTCGAATCCTAGCTAACGGGAAGATAGGAT
AATTATCTCAACGTTTCCAACCCGTATGGAGACCGCATCAACCGGTTTCAGCAACGCCTGGTGCATCAATTGCTACACAA
TGAGTTTCCTGGAAAGTTCCGGGGCTACTGCAAGTTCAACACATTCATGCAGATTTCGAAAGTACAGGACCAGGCTGATA
TGAAAGTAAGGGGCTCGATCATCTGTCCTCACTCATAGCATTTTTGGGACTTCACTGACTTTCGTTTAAAGTTCAGGAAA
GAAAGAGACGAAAGTCGGCTTGCCTGCTTAAAGAGCCAGAGAGGTGCGAAATCAAAGGCCGAAGTTCCAACGTGGACTTT
AGCTAACTATGCAGGACTGAGATATATCTTGGAGGCTGTATGATCAAGCCTCTAATACGGGCATATTGCCAACTTCCCTC
GATCTATGATTTTCAGGAGACAAAAGCTAATGCCAGGGTTTTCAGTTGGTTGGGGGTGACTTTGCCATGGATGCTGCAGA
CGTTGCTGAGCTAGATGACGATGCCACAAGCCGCAACAGCCTGAGGACCCAACTAAAACGCTGCGAGTGGAAGTTAAAGC
AGCGGCAACCAGTGCTTGTCGGCCACAATATGCTTGTAGATCTCTGCTTCCTGTACCGGACATTCTTTGAAACACTGCCT
GAAAATTTATCAGACTTTAGCCACAAGATCCACGAGCTTTTCCCCCGGATCGTCGACACAAAAAATCTTGTGGCTCGAGG
CGGACACGATATGCACACGGTAAACAATCTTCAACAACTAAGTACAGAAGCAAACAAGCTGCGCAAGCCAGTGATTTTGC
GTTCACACCAACGGGGCCGTACCGGTTACAAGGACGATAGTGCTCATCATGCGGGGTACGACAGTAGGTTATAATATAAC
TGCATTCCAGGCACTGTGATACAATGCTAAAATTATCTGACGTACAAAAGGCAACATGACTGCTACACTTTTTGTCAAGA
GGACCTGGCAAAAATACAGTGAAGGCCCTGACGACAACTCGAACAATGCAGGCGAAGAAACGGCACCGTCTTCGCCCACA
CCAGCTTCCAGTCGCCGCAAAACTTGTCCGAGATTGCCTCCCTGGGAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62