GenePrediction:GLEAN_6018 Details

Name: GLEAN_6018
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:464291..462738 (- strand)
Length: 1554
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:464291..464237 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_82:464175..464032 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_82:463952..463619 (- strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_82:463547..462970 (- strand)
Length: 578
Type: CDS
Source: GLEAN
Position: GCSC_82:462904..462738 (- strand)
Length: 167
>GLEAN_6018 class=GenePrediction position=GCSC_82:464291..462738 (- strand)
ATGACGCTTAAAACGCACGACCGTCCGTACGACATTGTCGTCTTTGGCGCTTCCGGTATGACGAAAAGAGGGTATTTTAG
GCCGAAATTCACCCCGCTAACATCACGTCACCAAAGGATACACTGGTGCTTGTGTGGCTGAGCACATCACGGCAAGCTTG
CCAACGACGCTGAAATGGGCGCTCGCTGGTCGCTCTCACGACAAGCTGACCAGGCTGGCCGCCCAGCTGAAGGAGTTGAA
TGCTGACCGCAACCAGCCAGGTAAGCTGACCCGACGTGGTCCTTGCCGTATCACAATCAGGCGGATTGGAGCTGACGCGG
GGATTTCGGTACACTCAAGCCATCGAAATCGTTGCAGCCACCGACGAGGATTTGGACAAGCTGGCCAAGAAGACGTTTGT
GCTCATCACCACCGTGGGCCCATACATCAAATATGGAGAGCCGGCATTTCGGGCATGTGCACAGAACGGCACCCATTATT
TTGATGTCACAGGAGAGGTGCCCTTTTCTGCTCGCATGATTCGCAAATACGAAGCCGCAGCAAAACAATCCGGTGCGATC
ATGCTGCCCCAGTGCGGAATTGAGTCGGCCCCGGCCGATCTTGTCACCTGGATGGTTGCAAAGACTATCCGGCAGCAGCT
TAAGGCCAACACTGCAGATGTGACCGTAGCCATGTCCCTGAGGCGAGTCTGCATCATTAGGCGCGTCTTGTCGACTTCTT
CAAGGTTTCCTGACACCGGCACAGGGCGGCTCCTTCTGGTGGCACACTCAATACTGTATTCACTGGCGCTGAGTTAGTCA
CTCTCAAGGAGCTGCGCGAAACCATGGCCCCGTTCGCACTGTCGCCAGTGCTCAAGAACAATCCGACGCGGGGCCAGTTC
TCAATTCTCCAGTTGCTGACGGGCATCATCCGGGTTCCGAACCTTGGCTTGCTGACGACTGCCTTGGCCGGCTCTTCTGA
TGCGGCCCTCGTCGAGCGCACATGGGGTCTGCTCTCAAGCACGCCATCCCGGGAGCAAGAGTCTTACGGGCCCAACTTTT
CCTTCTGCGAATACGCGCGTGTGCGAAGCCGTCTCCAGGGCTTTATCATTCACTGGGGTTTGGCTGTTGGCAGCGTCCTC
CTGTTCACGCTGCCCCCTTTACGCTGGCTCGCCAGGCGATTCGTCTATCAGCCAGGCGAAGGTGCCACAAAAGAACAGAG
TAAGAGGGACCGGATCGAATGTCGCGCAATCGGCAATCCAGACTTCGACGTCGCTACCGAGACTGGGAAGCCACGACAGC
AGGCTTTTGGCCGGGTATTGTACAAGGGAAGTATCTATGCGCGTATGTGAAACTCCTCAGTACTTTTGTCGCTCTTGGCG
TATGAATTTGCTGGCTAATCGTCATAGTCACCGGCGCTCTCGTGGCCGAGGGTGCCCTGACGGTGCTAGAAGATGATGTC
CGGCTGGACGGAGGCATCTATACTGCAGCCCTTCTTGGCCAAGGGTTTATCGATCGACTTGAAAAGGCAGGCGTGGAATT
TGAGGCAAAGGTGATTGATGTCAGTGAACAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62