GenePrediction:GLEAN_601 Details

Name: GLEAN_601
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:867132..868536 (+ strand)
Length: 1405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:867132..867291 (+ strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_97:867353..867620 (+ strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_97:867675..868536 (+ strand)
Length: 862
>GLEAN_601 class=GenePrediction position=GCSC_97:867132..868536 (+ strand)
ATGGATGGCGGATCAAGCATGACTGTTGGCGGGAGGACGGCGAGCCTGTATGTGGCCGCCGCCGCCGTCCGGCTCTTCCT
CTTTACCTTTTTTCCCCGGCTGCCTGACCTTTTGACTGGACGTGTTGAGATCTCCACGCCGGTGACCAGCTTCAAGCGAT
GTGGGTACTATCTTGTCCCCTCTGTCAGCCGTCGCGCTTGTTCCTTGCTGACCTGCTATAGTGCAAGAGGGTCTCTTCCT
CTACAACCACAACGTGTCGCCCTACGATGGCGGCGTCTACCACCAGGCGCCGCTTCTGCTGCCGCTCTTCTCTTTGCTCC
CGAGCGTCAAGACGCTTCCGATCTTCACCGACCTTCTCTACATTGTCGTCGATCTGCTGTGTGCCAGTGCGCTCTACTCG
ATTGCCGAGTCTGGCGAGGCCGGCGCTTCGGCACGGTTCAAGTCGCCGCGTCGGGACAAGCGATGGAGTGGATTTGTGAT
TGCAGCAGTGTAAGTCTTTTGCTCTTCTGCTCTTCTGCTCTTCTGCTCTTCGCTGACCTCTAGTTTCCTCTTCAACCCCT
TCACCATCGCAACGTGCGTCGGTCGCTCGACCACCGTCTTCTCCACCTGCGCCATTCTCTACGCCATCGCCAGGGCTATT
GCAGGTGCTCCCATCAGCGCCATGGTCTCGCTCTCTTTCGCCGCCTATCTGTCCATGTACCCCCTCCTACTACTACCACC
ACTCGTTCTGCTTGCCTTTGACCGCCAGCGGCCTTCCCAGCACGCAATCTCCTCGCTGTTGCCGTTTGCCACCACCCTCG
TGCTGGCCGTGGCCGGCTGCCTCGCCGCCCTGCTCGCCATGTCCTACTTCCTCACCGACCACTCCTGGGAATTCCTGAGC
TCGACGTATGGCGTGCAGCTGACGCTGTCGGACCTGGCGCCCAACGTTGGCCTCTGGTGGTACTTTTTCATCCAGATGTT
CGACCCGTTCCGCTCCTTCTTTGTCGCCGTCTTCTGGCTGCACCTCTCCAGCTATGTCGGTGGCCTCTCGATTCGCATCC
GCAGCCAACCACTCGTCGTGCTGACGCTGCTGTGCGGCATCTTTGCCATTTTCAAGCCGTATCCCGGCATCGGCGACACT
GGCCTCTTCCTTGCCCTCGTGCCGCTCTTCCGCCACGTCTTCCCCCTGATGCGCTACACCTTCTTCGTCGCTGCCACCAT
CATGTACGCCAGCTTCCTCGGCCCGGCCTTCTACCATCTCTGGATCTACGCCGGCAGCGGAAACGCAAACTTCTTCTACG
CCATCACGCTCGTCTGGAGCCTCGGCCAGAGCCTGCTGGTGTCGGACCTGACCTTTGCCATCCTGCGCGACGAGTGGGAG
GTCGAGCGGCCCGAGATGGTCGGCAAGGAGATCCGCCAGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62