GenePrediction:GLEAN_6020 Details

Name: GLEAN_6020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:458150..456020 (- strand)
Length: 2131
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:458150..458092 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_82:458007..456615 (- strand)
Length: 1393
Type: CDS
Source: GLEAN
Position: GCSC_82:456552..456379 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_82:456178..456020 (- strand)
Length: 159
>GLEAN_6020 class=GenePrediction position=GCSC_82:458150..456020 (- strand)
ATGTCTCTCAACATACCCAACGCGCCGAATGCAGGCCTGTTCAAGCAGGGCTACAACAAGTGTGTCTGGCCGCCAAGTTT
CCCCTCCATAGGCCGAGATTAGGTTATCCCCCACCTGTTACTGACACGTGTGGCTGTCTGCAGCTATGACTCGGAAGACG
GAGCGGTCCTCCGCAACATCGATGCCTGCCGTGCCATCTCGTCGACGGTGCAGACATCGCTGGGTCCGTACGGCCGCAAC
AAGGTGGTGATCAACCATCTCCAGAAGATGATCCTGACGTCGGACGCGGCAACGATTCTGCGGGAGCTCGACGTGGTGCA
CCCGGCGGCCAAGCTGCTCGTGATGGCCAGTCAGCAGCAGGAGGCGGAGATGGGCGATGCGACGAACCTGGTGATTGTGC
TTGCGGGCGAGCTGCTGCGCAAGGCTGAAGACCTGCTGCGGATGGGCCTCAAGACGGCCGACATCGTGACGGGCTACGAG
CGTGCGCAGAAGTTTGCTCTCGAGACGCTCGAGGAGCTGACGGTCGACAAGGTCGGCGATGTGCGGTCGCAGGTGGAGCT
GAGCAAGGCCATTCGCACGGTGATTGCGAGCAAGCAGAACGGCAACGAGGATTTTCTGGCGAACCTCGTGGCCGAGGCGG
TGCTGGCGGTGATGCCCAAGAACCCGGCACTGTTCAACGTGGACAACATCCGGGTGGTCAAGATCATGGGCGGCAGCCTC
GAGCAGAGCCGGGTGGTACGCGGCATGGTATTCCCCAAGCCGCCCGACGGGACGGTGAAGAAGGTGGTCAAGGCCAAGGT
CGGCGTGTTCTCGTGCCCGATCGACACGAGCCAGACGGAGACCAAGGGCACAGTGCTGCTGCACAACGCCAAGGAGATGA
TGGACTTCACCAAGGGCGAGGAGGTGCAGCTAGAGGCGGCCATCAAGCAGCTGCACGACGTGGGCCTGCGCGTGGTCGTG
GCCGGGTCCACAGTCGGCGAGCTGGCCATGCACTACCTGAACCGCTACGAGATTCTCGTGATCAAGATCCTCAGCAAGTT
CGAGCTGCGCCGGATATGTCGCGTAGTGGGCGCGACACCGCTGGCCCGGATGGGCGCACCCATGCCGGAGGAGATGGGCA
GCATCGACGTGGTGGAGACGCTCGAGGTGGGCGGTGACCGTGTGACCGTGTTCCGGCAGGAGGACGAGGTGACGCGGACG
GCGACACTGGTGCTGCGCGGTGCGACGCAGAACCATCTGGACGATGTCGAGCGGGCGGTCGACGACGGGGTCAACGTGGT
CAAGGCCATCACCAAGGACGCACGGCTGGTGCCGGGAGCGGGTGCCACGGAGGTGCAGCTGGTCGAGCGGTTGCAGGCCT
TTGGCGAGAAGACGCCCGGCCTGGCACAGTACGCGATCAAGAAGTACGGCGAGGCCTTTGAGGTGGTGCCGCGAACGCTG
GCCGAAAGCGCCGGCCTGGACGCTACGGAGGTGCTCAGCCGGCTGTATGCGGCTGCACACAAGAAGGACGAGTGGACCTA
CGGTGTCGACGTGGAGGTGAGTTTGTCGGGAGACGGACAGGTCTTTGCGCTTGCAGGGCCATTGCTGACCACCGACAGAA
CGACGACGGCACCGGCACGCTGGACGCCAAGAGCGAGGGCATCCTAGACCTTCTTGCCAGCAAGAGCTGGGCCATCAAGC
TGGCGACCGAGGCGGCTCGGACTGTTCTCTCGGTCGACCAGATCATTGTGGCCCGGCAAGCCGGTGGCCCCAAGCCCCCA
GGGCCGAACCCTGTAAGTCGTCTGCCTGCATGAGCAGCAAGACACAAGGACAGAATGCTGACAGCCTAGAACTGGGATGA
GGACTAGATGCCTTGGCCGATGGCCCCGTCTGATGGGTTGTGATGGGTTGTCCGTACGTACAATGCCACGCCAAACCTGT
GGGGGGACATTTTACTAATCACGGGCATTTCTTTCTGTCGCTATCCGCACAGGACATAAGAGAAGTCAGGCTGTTCCAGC
AACACATCTGCGAGTACAGCTACTCTTGGAGACAGGGGCTGGACGCAAGAATGGAGCTGTTCGGCGGATCTACGGATAGA
GTCGCCACAATGCTAGCACACATTACAGGCAAGACGAAAAAAGCCTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62