GenePrediction:GLEAN_6021 Details

Name: GLEAN_6021
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:449451..446060 (- strand)
Length: 3392
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:449451..449208 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_82:449134..447385 (- strand)
Length: 1750
Type: CDS
Source: GLEAN
Position: GCSC_82:447329..446060 (- strand)
Length: 1270
>GLEAN_6021 class=GenePrediction position=GCSC_82:449451..446060 (- strand)
ATGAACGCAGACAGGAGCCGTTCCCGTAGGGAACGCACCTTCGTAGGCAGTGAATGTGCTGTTTGTGAAGAACCGCTCGA
GCACACTCTCCGCGGCGAGCGCATATTACAGTTTTCGTGTGGACACGTTTCCCACGAGGCTTGCTTTTACGAGTTCATCC
GCGAGTTTGAGTCACAATACTGCCCAACATGCAACGCGCCGCTCCATCTAGACACAACCCGCGGTGGCAACGTTCTTGAC
ATCGGTGAGAAAGCACTCCTATCGTATTCTTGCTTGCTAGTAGTGCGTTCAATGTGTCTAATCGGCGTTCTCTGCAGAAA
AAATCAGCAATATGATGAGATCGGTGTCTGTGAATGACAGCCGGTCTGTCAGCACTCCCACACCTACGCCTGGTTGGGAC
GACCAAAGCACACGTCCGCCTAGCCGGAGCTCTAACCAGCGGCACAACGGGGGCATGAGCACGGCCAGCGCTGGTATAAG
CATGAATCATCATACGAGCACTCGCGACAGCTCGACCGGAGGTAGTTACCGTGATAATCGCGAACCACCATCTGCGGATC
GCTTTACCGCCAACTCGAGACATACGCGCAGCGACAGCGAGGCCACCGGGATTGCCTCATCTGGTGGATATCCCGAGACG
ACGCAGAGCGGCGGCCCTCGCCGAGTCCACGACTATGATGTGCAGGCCATGGAAACAACACTGACCAGTCCACGGGTGGT
GACTCGGAACCCCATCCCGGCGCCAACAGTCACAGTCCGCTCCGAGTTTCCCACAATCAACCGTTCTCGCCAACAACAGA
CCCTCACCTGTCTCGTGACCATAGAGGTCCCCGACTGCAAATGGCGCGCGGATCCAGACGACCTGCAGACAGGCGCGACT
CCCACACAACAGCAGCCGGCACCGGGACCACGGCCTCGTAACGGCGAGGATGGCCGCGGAATTGCATCACCTGTCCCCAG
TGCCCCTCACTTTTACCCGTACGAATCCCCAGAGGTTCTCGAGGAAATGACAGAAAATCTTCGAGGGCGTGTCGATAACT
GGCACGGGCTCGATTTCAGCCGCTTTGGTAAATTGCGGCTTTACGGCACTCTGCGTGTTGGCAAGGACAAGGTCTCGTGG
CAGGAGCTAGAGTGCTTCTTGTTTGCCGAGATGCTCATCTGCGTCAAGGAGAAGAAAAGTGCGGCGGTCGCGGCGCTTGC
TGCCCAGCAGCACTCGCGATGGGACAACGGGGCCAACGGTCAACCACGCAAGACGACACGCTGCACTTTGAAGGGATCCA
TTCTGATCAAGAAACACCTAAACGAAGTGATGGAGACAGGGGCGATGGACGAAAACGTTCTGACGCTGAGCTTGTCTGTG
GCGGAATTGCCCCAGTTCCATCTACGGTTCGACAACCGCAATCAGCTGAAACTATGGCACCAAGCATTGTTGGACCTGAA
TGCCATCGAACCGACGCCGTTGCGTAGTCCTGATTATGACCGTGGCGACCTCTCGGAGCCAGAAGAGGACGAGTGGCAGC
AGCAGCAACAGCAGCGTACACCAGGCAGCGGAAAGACGCAGCATGGCTCGTCTCTGGCGTCATCCTGGGGCGGGGGCAAG
TCGGTTACGACAGCCCCGACTGAGTACACCAGCTACGCCAAGAGCGCTGCACCACCAATCAGTTCGCTCCATGTGCCTAT
CGATGTGGTGGTGGTGGTTCCCATTTCTTCTTCGATGCAGGGCGTCAAGATCAATCTGGTGCGCGACGCGTTGCGATTCA
TGGTCCACACGCTTGGCGAGCGTGATCGGATGGGTCTCGTGACGTTCGGATCTGGCGGCGGCGGTGTGCCTGTGGTTGGT
ATGACGACGAAGTCGTGGCCAGGCTGGAGCGGCGTGCTCTCATCGATCAAGCCAGTGGGCCAGAAGAGTCACCGGGCGGA
TGTGGTTGAAGGCGCCAATGTTGCCATGGACTTGCTGATGCAGCGGAAGTACAACAACCCGATTGCGACAATCATGCTCA
TCAGCGACGCCTCGACGTCTGATGCTGACAGCGTCGACTTCGTTGTGTCGCGTGCTGAAGCAGCCAAGTGAGTTCATTGT
CTCGCCTTGGGCCTCTGCTATACAGCCTTTCTAACATTACAGGATTACAATCCATTCGTTTGGACTGGGCATGACGCACA
AGCCAGACACGATGATCGAGCTGTCGACGCGGACAAAAGCGTCCTATACCTACGTCAAGGACTGGATGATGCTGCGGGAA
TGTCTTGCCGGCTGCCTGGGCTCGATGCAGACGCTGTCGCACCAGAACGTCAAGCTCAAGCTGAAGCTGCCCGAAGGGTC
TCCGGCAAAGTTCCACAAGATCAGTGGCGCTCTGCAGATTACGAAACGTGCCACCGGACGAGATGCCGAAGCATCACTGG
GCGACTTGCGCTTTGGCGATAAGCGCGACATTCTCGTGCAGCTGGTGATATTGCCAGACAACGCATCACAAGAGCAGCTG
CCCCAAGACCCGTGGGAGACGATCGTGTCAGGACTGGAGGCGCTTGGCGGGCCGATGGACCAGGACGAGCAGCGGGTGGT
GTCGATCGAAGAGGTACCGCTGATTCAAGCCGACCTGAGCTGGGGCGATATCCTGCGCGATGGCACGGTAGTGCATATGC
CGCGGCCATCCTTGTTGGCGATCACCATGTTGCCGGCGCTCAGTCAACAGAAGTCACGGTCGTGGCAGAATACGCCACCG
ATCCCACCGCATCCGAGCATCGTTCAACGACGGATGGAGCTGTTGACATCAGACATGCTGACGCGAGCGTTGACTCTGGT
CAGCCGTGGCCAGCATGAGCGCGCCCACACGCTCCTTCACGAGACCCGATCGATCCTGAAGGGCCTCGGAAAGGGCGGCC
TGCCACCGGTGCCACCTTTGCCGGGCAACGGCAAGGCATCGTCGCCATCAGTTCCATCAACACCACACCCGGGCACTGAG
GGATCGCCATCAATGGCCCTGGACACGCCAGACCGAAAGCGCACGCCGTCTCCCTCGGCCTTGGGAATATCAGGCATAAC
GGCCGGCTTCCCTGTTCCTGGCGGGAACCTGCCTCGCATGCGGTCCAATGATGGCCTCACCATGGGCGTGGGAACGGCCG
CGGGAATTGACGCCAAGGCGGTCGCTGCTCTCGATGCCGAGCTGGAGGCGAGCCTGGAATGGATAAACCACCCGGCCGTG
TTCGGGCGTGACAGCCGCAAGGCGGTGCTGCAGGCGATCGGCGTGATCAGCTCGCAGCGGGCATATACATTCCGGACGCC
TATCGAGAGCTTGTGGGCGACGCGGGTGACGGGTGTGAAGCGGCTGACCGAGAGGAGCCGCGAGTGGCGCGAAGAAGGCA
GCGTTGAAGGCGGCATCAGGGAAGAGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62