GenePrediction:GLEAN_6022 Details

Name: GLEAN_6022
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:444334..442088 (- strand)
Length: 2247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:444334..443959 (- strand)
Length: 376
Type: CDS
Source: GLEAN
Position: GCSC_82:443739..442088 (- strand)
Length: 1652
>GLEAN_6022 class=GenePrediction position=GCSC_82:444334..442088 (- strand)
ATGACCGTGCGAGACGGTCGTCCTGTCGACAACGACGACAGCACAGCCGACCACGGCACCCGGCTTCTCGACGACACAGG
CGCGCCGCACGCATACGGCGCCGTTCTGGCCTCCGACAGCCAAGACACCGGCTCGACTAGCGCTCCGCGACCGACCCGCC
CAGACGAGGAGGAGCTGGCTCGGGAAGCGCTGGACGACACAGACATGTCTCGACCGACGCGGCACCTCGCGATCGCCTAT
GCCGGGCTGCTGCTGCTGGCATTCACGACGTCGCTCGAGGGCCAGGTGACGGCGCCGTTGGCGGCGTTTGCCGTCAGCTC
GTTCAACAATCACTCGCTGCTGTCGACGGTGTACGTGGTGCAGGGCGTAGTCAATGGTGGGTGATGTCGCGTTTGGTGCA
GATGCTTCTATTCAGGGTCTTTTCAGATGGTCTTCCTTGCAGATGCTCCTTCCTTATTGTCTTCCTTGCTCCTTTCAGAC
GCTCCTTCCTTCATGCTCCTTCCCCCAATCTATTTCCACGGTCTACCTTTTCTCCCTGACGTATCTCTCTTCCCTTCTCC
ATCTTCATCTTCATCGACATGTCCTGACTTTCCAGCCGTGATCAAACCGCCAATGGCCAAGATGGCCGACGTGTTCGGCC
GCCTCGAGGCATTTACGGTCGCCATACTGTTCTGCGTTGCCGGTTACGTGCAGATGGCGTCGTCGCACAGCATCCGCACG
TTCTCGGCCGCCCAGATTCTCTACTCGGCCGGCATCACCGGTCTGCAGGTGCTGCAGCAGATCCTCGTTGCCGACACGAG
CGACCTGCGTCACCGCGCCCTGCTGTCCAGCCTGCCCGACACGCCCTTCCTAGTAACGGTCTGGATCGGCCCCAGCATCG
CGGCAGCCGTGCTAGCAACGACGTCCTGGCGCTGGGGCTATGCCATGTGGGCCATTCTGCTGCCACTGGCCTTTTGTCCG
CTGGCTGGCTCGCTCGCCCTCAACGCTTACCAGACGCACCGCAGCCACCGCCAAGGCCGACTTGCGCGCGGCTGTCTCGG
CCTGACGGCCGTCTCCGGACCTGCAACCTCGTCTCCGACCGGTTCAGCCGTCTCGACCAACTGGACCACCTCCAAGGCAT
CATCGGCCTTGCGGCGCCTCCTTACCGATCTCGACGCCGTCGGGATCCTGCTGCTAAGCGCCGCCCTGTCACTCATCCTG
TTGCCGCTGACACTGTCGCGCTCTCTGGCTGGCGGCTGGTCCAACCCGCTGCTCGGCCTCAGCGTCATCGCTGGCCTGCT
GCTGCTCATCTTCGCCTTTCCGGCCTGGGAGGCTCGCCCGCATCTGGCACCACATCCGCTCATCCCGCTGGCTCTGTTGC
GCAACGTCACTTTCTGCGCTGGCTGTGGCGTCGGCCTCTTCTTCTTCGCCGTCTTCTACCTCTCGGTGCAGCCATACTTT
TACTCGTACCTACTCGTCGCTCATAACCAAGAAATCGCCACCGCCGGTCGCATCACCCAGATCTTCTCCTTCACCTCCAC
CATCTGCGCCGTCTCTGCCTCCATCGCTATCCGCCATGTCCGCCGCTACAAGCCGTTTGTCGTCGCCGGCGCCACCGTCT
ACCTCGTCGGCGTCGCCTGCATGCTGCGTCACCGCACTGCCGATGCCGGCACCATACGCCTCGTCGCCACTCAGATCGCC
GTCGGCTCTGGTGCCGGCCTCATGAGCGTGCCCACACAGATTGGCATCCAGGCCAGCGTCGCCCACATGCCTCACCTCGT
CTCTGCCGCCACTGCCGTTTATTTGACCATGGGTGAGGTCGGCATCGCCATCGGCTCTGCCATCTCCGGTGCCATATGGG
GCCGCCTCGTCCCTGCCAAGCTCGAGCTGTATCTGCCGTCGGCTGACCGCCAGAACGCCAGCGCCATCTACTCCAGCGTC
TCTGTCGCCCTGTCCTACCCCTGGGGTAGCCCCACGCGCGACGCCATCATCCGTGCCTACCAGGAGTCCATGACCGCCCT
GTTGTACGTCGCTGTCGGCTTTTGTGTGCCCGTCCTGCTTCTGGCCTTGCTGATGCGCGACTACCGTCTGGACGGAGGAA
ACGAGGCCGCCGGCAGCAGCAGCGATGCCGGCGATGATGCTGTCGAGGCCGAGCCGCTCACACCTGTGGCTGTGAGTGCG
GGTGCTCATGGCGGCTCCTTCGCCACTGCCGACGAGCGGGTCAACCTGCTTTCGGAAGAAGCCGTGAACGAAGTTGAGGA
CGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62