GenePrediction:GLEAN_6024 Details

Name: GLEAN_6024
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:435396..433034 (- strand)
Length: 2363
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:435396..435387 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_82:435327..435288 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_82:435224..433034 (- strand)
Length: 2191
>GLEAN_6024 class=GenePrediction position=GCSC_82:435396..433034 (- strand)
ATGGCAACGAGTAGGTGCTTGCGTTTTCGGTGTTTCTCTTTCTGTTCGCCGCCTGCTAATGTGTACCAGACCGCGAAGAG
CGCTGGCAGCAGCGCATGCGAGGTGCCCAGTAAGTTAGCGAGAAAGAAGACAGCTCTTCCGCTGGAGCCAAGCCGCTGAC
TGTTTGAGCAAGACGACACCAGGTGCAGGAGGCGGCGTTTGATCTTTTTTTCCCGGAACCGGAACCAGAGCCCGCATCCG
AGCCGACAGAAGAGGAGGCCGCTGTCGAGACCGAGCCGACGCCGGCAGCTGTGCGAGCGAGCCCCAACACGTCTGCCAAG
AGGAGGCAGCTCGATGGGGAGGATGAAGGGCCCGTGGGGGTGACGGCAGCGGTGCGGGTGGCCGAGGAAGAGCAGGTGGA
CGAGAGTCCGATGGACGCACCGGGCAGCGGGCGGCGACGGTCGGTGGCGGTGGGCGCAGCGGCCGACCGGACGGCCGCCC
TGCAGGAAGCCTTTTCGGGATCACCACTGGGCCGACGAAGCGGCATGCAGCTGGGAGACGAGCAGGTGATGGTGGCAGCA
TCATCATCCCCTCCGGTGGTGGGTGCAGGTCGGCGACCTCCGCAACTGTCGTCTGGGAATGGCGGAGGCGCGAACGAGAC
CCAGGACGAGGCTCAGGACGAGGGCCAGGACGAGGGCCAAGGCGACGACATGGACAACGGACAGGAAACTCTGTCTCCTG
AGCTCGCGTCGGCCGTCGATACGACCCGAGCAGGCGGCCGCACCAGTCTGTTCTCGCGGCTGGCTCGCGCCCGACGCAGC
GCGGCCGCGACGGCTGACGGAAGCGGCGATGGCCCGGACGCTCTCGACGAGCTGTCGTCGCCGTCGCTTCCGGGCGTCGA
GCCGGCGATCATGCCGTCGTCGTCACCGCTGGCTCGCAAGTCGGCCGCCAACGTGCGGTCAGGTAGAGCCGGACCGGGAC
CGAGACCGGGACTGCGCCGGCCAGGCCGCAGCACGCTGGCCGTGGCCGTGGCAGCCGACACAGACCGCGACGAGCTCTCG
CCCGAGCAGCCGCCTCCGCTGACGGTCATGCTGACGAGGCGCACGGCCGAGGTGCCGTCATCATCGCCGCCAGCTCAGGA
GGTGAAGCGCCGTCGGGGCAGGCCGCCGGCCGTGGCAGCGACGGTGGAGGTGGAGGAAGAAGAGGCAGAAGCCATTGACG
AGGTGGAAGCTGCTCGGACAATTGGCAGGAAACGTCCACAAAGGAGCAACGTGCACGAGCCGTCACCGGAGCTGGGATCT
GACCGTAAGGCAGCGGAGCCAGAGATCGTGCCGATGGCCAAGCGACGACGACGACCAGGTCCACAGCAGCAGAGCCCGGC
TGTGCAGAAGCAGCCGCGGGCAGCGAGGGAGAAGGGGGTGGAGGTGGTGGAGGAGGAAGTACAACAAGAGCAGGAGCTGC
AAACACGTCCGACAAAGACGAGAAAGGCGAGAGCACCGGCTGTCCGGGAACAGACGAATCAAAAGAAGAGGAAGCGACGA
CAAAAAGAGGCAGAAGAAGAAGAAGAAGATGGCGAAGTCGAGACCGAGGGCAACAGCACGACAAAGGGCCGCAGCGGACC
TCCAATTCCCATTACGGTGCAACGATTCAGCCGGCAAAGGCGAAGGACGAGAGCGGGCAAAGACGATGGCGACGATGACT
TGGACGACAAGGACTCGGACTCGGACAACGGAGACATACCGTATGCGAACCGCAGCGGGGTCAACGTGATCGACGTGCTG
GCGCAGGTGTGCGAAGACATTGTGGCGCAGAAGCTGGAGGAAGCGACAGCACAGGCAGCCGAGGCCAAGACAGCAACGGC
GGCCGGCGACAGCAGTGCGCGCGAAGCCCGGCGAGACGCCCTGGCGCGACAGCAGGCCCTCGAGGCATTCCAGGCCGAGC
TACGAGCACGTCTGCTGGCACAGGCGGCAGCTGTGGATGCAGCCTTGGCGCTGCGACGCCGCGTGCGGGCAGCCCATCGA
CAGAAGCTGGCGCTGCGCGAAGAAATCCTGCGAATCCGCGCCGAGAGAGAGCAGGTCGCCCTGCGGATGGACGCCCTGCG
AGCACAGCACCAGGAGGCGAGTAGACGGGCGATGGTGAGCGCAGATATGTCCACGGCCATGCACGACGTCGATCTAGCCG
TCGAGCAGGGCCGCACTGCCCCCGACCTCACGGCTGCCCAGCAGAAGACGGCAGAGCTGGGCAACCTGGAGCTGGTCGTC
AGCCGAGTGGCAGAGCAGCTGTGTGGTGGTGGTGGTGGCGGTGGTGGCGTGCTGCAACAGATCATGGACTTTAACGCCTT
TCTCGAACGGACGGCCGTCATGCTGGAAGGCAGGGGGACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62