GenePrediction:GLEAN_6026 Details

Name: GLEAN_6026
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:428194..427113 (- strand)
Length: 1082
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:428194..428078 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_82:427976..427916 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_82:427482..427244 (- strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_82:427181..427113 (- strand)
Length: 69
>GLEAN_6026 class=GenePrediction position=GCSC_82:428194..427113 (- strand)
ATGGCTACCGAGCTGACCGTCCAGTCCGAGCGTGCTTTCCAGAAGCAGCCGCACATCTTCCTCAACTCCAAGACCAAGGT
CAAGACCTCGCGGCCGGGCAAGGCTGGACGGAGATGGGTACGCTTTGACACAACCTCCATGTCTCGCTTCGAAAGAGAGA
GGCGAGAAGAATTCGCACCGCGATCGGACTCGTTTCGCTGACTTTACTGGGAATGTAGTACAAGAACGTTGGTCTGGGCT
TCCGGACGCCCAAGGCCGCCATTGAGGGCAGCTACATCGGTAAGCTTGTTGTCAGAATGTGATGTGGAGGGCACAGGGCG
CGAATAGCGAGAGGGGCTCTGAAAATGTTCGACCGGCTGGCTGCATGGCACACGAGGCACCCTTGGCATCTCGAAGACCG
AATCCGACACGACCAAGCGATTTGTGGGAGGGAAACTTGGGGCTTAGATGCTCTCAGAAGATGAGGACTGGTAGCGTTTG
GTAGCGGTCTCCGCGCCCAATTTGGCATCGCAACAACGACGACAAGACGTAACGGAAAAGACGCGCAGCTCGGATGGTCG
CCGACAGCACAGCTCGCCCTATGTCTAACTAGTCAGCCAGCCAGCCAGCAGCAGTCGTTTCGATATTTTCTGATCCCGCG
TGACCTTGAGCGGCTTGAAATGATATGAAGAGGAACTGCATTGCTGACCGAGGTTCTTTTCCCTCGCTGCAGACAAGAAG
TGCCCCTTCACCGGCCTGGTCTCGATCCGTGGCCGTATCCTTACCGGCACGGTCGTGTCCACCAAGATGCACCGCACCCT
GATCATCCGGCGAGAGTACCTCCACTACATCCCCAAGTACTCCCGTTACGAGAAGCGGCACACGAACCTGGCGGCTCACT
GCTCGCCCGCTTTCCGTGTTGAGGAGGGTGACCAGGTCACCGTCGGCCAGTGCCGCCCCCTGAGCAAGACTGTAAGCAGA
CCCTGAAAGACGCGGGCGGGGAGATGAGAGGAAGCAAGCTAACCAGCTCACAGGTCCGCTTCAACGTCCTGCGCGTGCTT
CCCCGGACCGGCAAGGGTGTGAAGAAGTTCAGCAAGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62