GenePrediction:GLEAN_6028 Details

Name: GLEAN_6028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:420183..418361 (- strand)
Length: 1823
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:420183..419896 (- strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_82:419830..418361 (- strand)
Length: 1470
>GLEAN_6028 class=GenePrediction position=GCSC_82:420183..418361 (- strand)
ATGGCTGTGACTGACCAGGACATATTCTCCAACGTCTCCTGGAGCAGCGACCAACGTGCGACAAGCCTTGAAAGCGACAG
AAAGAACAGGAGCGACAGCGACGGAGACAGGATGGGCTCCGACTACCGACAGACGTTGCCGTCGTCGCCGTCGCAGCGAT
CGCGCGGCTATGTCGCCCTGGACGCAGACACGCTGGGACCCGAGGCCCTGCAGTGCACGGTGTCGTCGCCGCTGACGGAG
AATGAGGGCGGCAGCAACCCGTTCACGTCGTACCTGGTGACGACCAATGTAGGTGAATCTACTTTCTGGTTCTGTTTGTG
ATCTCCATGCCGACGAACGGGACATTCCTGCAGTCTACCTTTAGCTCGTTTCAGAAGCCGACGGTATCGGTGCGGCGACG
GTTTACCGACTTCCTCTTCCTGTACAACTCGCTCTGCAAGGACTACCCAGCGTGTGCAGTGCCGCCGATCCCGGAGAAGC
AGCGGATGGTGCGGGTGACGGGCGACCGCTTTGGGCCCGACTTTACGCGCCGCCGGGCATACTCGCTGCAGCGATTTTTG
ACGCGGCTGTCGTTGCACCCAGTGCTGCGACGGTCGGTGCTGCTGCACAGCTTCCTGGAGTCGGGCGAGTGGAATGCGAC
GATGCGCAGCCATACGGTGCGCGGCTCTGGCGACGGCTACGGCGGGAGCATCGGGCTGGGCGGCGGCAGTGGTGGAGGGG
GTGGCGGCATCTACGGCAGCGGAGGTGTGGGCGCGAGTGGTGGTGCAGGAGGAGGTGGTGGTGGTGGAGGAGGAGGAGGA
GGAGGAGGCGGCAGCAGCATGTTTGACGCGTTCGCGGACAGCTTCATCAACGTGTTCACAAAAGTGCACCGGCTGGACCG
GCGGTTTGTGGACGTGCGCGAAAAGAGCGACCGGCTGGACGAGGACCTGGGCCAGGTGGAGAAGGTGATGGCACGGGTGG
TGCGGCGTGATGCGGACATCGAGGCCGATCTCAAGGACCTGGCGGAACAGTTCCAGAAGCTGATCACGCCGGAGCCGGGC
GTCGAGGGTGCGGTGCGGGCCTTTGCAGCATCGGTCGAGGACACGGCGACGGGGCTGCGTGGCCTGCGCGAGATCACGGA
CCAGGACTACCTCAGCAGCCTGCGCGACATGGTGGCCTACAGCGGCTCGCTCAAGAACCTGCTGAAGGCGCGCGAGCAGA
AGCAGCTGGATTACGAGCAGCTGACCGAGTACCTGAACAAGAGCACGGCCGACCGGGACCACCTGGCGATGACGTCGGGT
TACTACTACGGAGGGAGTGGCGGTGGAGGTGGTGGTGGTGGTGTGGGTGGCCTGGGGGGCAACAGCACAGGCGGCGGTGC
AGTGTCTGTGGCTGGCGGTGATGCGGGCGACGGAGGCGGCGAGACGGCCAGCGGAGGCGTCTCGGGCGGGCTCGGGGCCG
TCAGCAGCGTCGGGGCAGCAGCATCGTCGTACGTGGCCAGCACGGGCGGTGGAGCACTGGCGGGGGCCAGCGGGTTTCTG
CGCAGCAAGCTGGAGGATGTCCGAGGGGTGGACCACGAGCAGAGCCGGCGAGAACGGCAGCGCAAGCTGGAGATGCGGGT
GGAGGAGCTGACGGCCGAGGTGGAGCGGGCGCGCAAGACGAGCGAGCTCTTTGACGAGGAGGTCGTTAAGGAGGTGGCCG
ACTTTGAGCGGATCAAGCGGGTCGAGTTTAAGCGGCAGCTGGGCGGCTTGGCGGACGCGCATATTGCATACTATGACGCG
GTGCATCGGGTGTGGGGGGAGTATCTGCGAGAGATGGAGAAAGAGGGTGTATTGGCGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62