GenePrediction:GLEAN_602 Details

Name: GLEAN_602
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:881005..884069 (+ strand)
Length: 3065
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:881005..881054 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_97:881122..883530 (+ strand)
Length: 2409
Type: CDS
Source: GLEAN
Position: GCSC_97:883589..884069 (+ strand)
Length: 481
>GLEAN_602 class=GenePrediction position=GCSC_97:881005..884069 (+ strand)
ATGTCAAAGTCATGGGCATCGACGTTGAGGCTGCCCCGATCCACCTTTCCGTACGTGTCCCAGAAGTGCATCGCATGTCT
TATCCTTGCTCGACTCTCGTCTGATCGTCGTGACCAGACCGCGGCCGCTGCCGGAACGCAGACCGGTGTACCTCCAGCGC
AGTGCGGATGATCTATACCGGTGGCAGGAGGCCCATCGGCCAGCGCACCGGCCGTTTGTCGTGCACGACGGACCGCCGTA
TGCCAACGGGACTCTGCATGTCGGCCATGCTCTCAACAAGATCCTCAAGGACATGAGCCTGCGCGTGCAGCTGCAACAGG
GCCGCCGCGTGCGCTACGTGCCCGGCTGGGACTGCCACGGCCTGCCGATTGAGCTCAAGGCGCTGGCGGCGTTTCCGGCC
TCACCCTCACCCGTGGCCATCCGCAAGGCTGCTCGCGACCTCGCTGCCCGCACCGTGCTCGAGCAGATGCGCGAGTTTCG
CCGCTTCGGCGTCATGGCCGACTGGGACGGCCGCTGGCGCACCATGGACGCAGCCTACGAAGTCCGCCAGCTGCGCCTCT
TTCAGCAGCTCGTCCACAAGGGCCTCATCTACCGTCGCTACAAGCCCGTCTACTGGTCGCCATCGTCGCGCACCGCCCTG
GCCGAGGCCGAGCTCGAGTACAGCGACCGCCACCTCTCGACGGCCGCGTTTGTTCAGTTTCCCATTGTCGGCGGTGTCGG
CCGCCTCGACTGCCTGGCCGGCCTCCGTCCTGGTCCTCTCTCTGCTGTCATCTGGACCACCACACCCTGGACCCTGCCGG
CGAATGAGGCTATTGCCGTGCACCGCGACCTGGACTATGCCGTCGTCCGGATCCGGACCGACAGCTCCGATGCCCCCGAA
TACCTGCTCGTGGCCGAGGCCTGTCTCGAGACGTTCAGCAGCATGTGCTGCCGCGAGCCGGACATGCTGTCAGACGTCGT
CGCGCGCGCCATTCCCGGCTCCGACCTGCTCGGGCTGCAGTACGTCAATAGTCTGCGCGGTCGCAGCGCCCAGCCCCAGC
CCATCATCCACGCCAGCTTCGTCACGGCTGGCTCGGGCTCGGGGCTGGTGCACATTGCACCTGGTCACGGCTTTGAGGAC
TACGAAGTCGGCATGAGCCACGGGCTGCCGGTGCCGGCGCCGGTTGACGGCGAGGGCCGGTTCACGGATGCCGCCTTTCC
AGATGAACCCGCCCGACTGACCGGCCTCTCAGTGCAGGGCGAGGGCGGCACGGCCGTGCTGGCGCTGCTGGGCTCAGCCG
TGCTGGCAACGCACCGGTACCAGCACAAGTACCCGTACGACTGGCGGACGAAGAAGCCGATTATCGTGCGGGCGACGGCA
CAGTGGTTCGCCGACGTGGCCGAGATCAAGGCCGCCGCCGTGGCCAGCCTGCAGACGGTGCAATTTGTGCCTGAGGCTGG
CCGCAGCCGGCTCGAGAGTTTCGTGCAGGGCCGCAGCGAATGGTGCATCTCGCGCCAGCGTGCCTGGGGTGTGCCCATCC
CGGCGCTGCTCGGCGACGATGGCAGCGTCGTGCTGACCGAGGCCACCGTCGAGCACATTGTCGACGTCGTGCGCAAGCGT
GGCACCGATGCCTGGTGGTCTGACCCGGCGGACGAGCCGGCTTGGATCCCGGCCGAGCTGCTGCATTCGGGCGTAACATA
TCGTCGCAGCACTGACACCATGGACGTCTGGTTCGACAGTGGCAGCAGCTGGACCCAGGCCAACGACGGCGCCCAGGCCG
ACGTCTACCTCGAGGGCACCGACCAGCATCGCGGCTGGTTCCAGTCCAGCCTGCTAACGCGTGTGGCTGCTCTCGGCGAT
TCCGATCTCCAGCCCGACGATCAGTCGCTGGCCCCTTTCAAGACGCTCGTCACCCACGGCTTCCTTCTCGATGGCGACGG
CAAGAAGATGTCCAAGTCGCTGGGGAACATTGTGCTGCCGGCCGAGGTCATGGACGGCACGCTGCTGCCGCCGCTGAAGC
CGCGCAAGGGCCGGTCCAAAAAGACGGAAAAGACGGAGACGACTGGAGCGCCTGGAGCGCCTGTATATGATGCCCTCGGC
CCCGACGCGCTCCGGCTCTGGGTCGCCACCAGCGACTACACCGGTGACGTGGTCCTGAGTCAGGCCGTGCTGCAGGCCGT
CCACACGACCTTGACGCGCTACCGCACCATGATCAAGATGCTGCTCGGCTCCATGCACGAGTCGGCCCGCATCGCCCCGC
TGACCACTCTGGACCATATGGCCGTGCTGCAGCTGCGCGACGCCATGGCCGATGTGGCCGCTGCTTTTGCCCGCTTCGAG
TTCTACAAGGGCATGGCCGGCATCAACCGCTGGCTGGCCAACGACCTGTCGGCCTTTTACCTCGAGGCCGCCAAGGACCG
GCTGTACTGCGCCGATGGCGGCGGCGTGCTCGAGCCCATCTTCCTCGGCCTGATGCGCATGCTGGCTCCGGTCGTGCCCA
TGCTGGTCGAGGAAGCCTGGGACCACGCGCCGGCCTGGCTGACAGAGTGAGTGACAGAAGCGTGACAGGGAAAGGGATGC
TGCATTGAAATGCTGACTAAGCAGATCCACTCTCCATCCTCTGCGAGAGCTGTACAAGGCGCCGCTCATCGATGTTGCCC
GGCTGCCCGGCGACGAGGCCCAGTTGCGCCAGGCCATACCCGTGGTCATGGCGGCTCACGCGGCTGTCAAGGCGGCGTCT
GAGCGTGCCCGCACAGACAAGGTCCTCGGCTCGTCGCTGCAGTGCTCCGTCGTGCTGGAGGTGCCCGTCTCGTCGGCGGC
CGAACTACTAAACGAACTCGGAGCCGAGCTCGATGCCATGTTTGTCGTCTCGTCTGTGGCCGTCAATGCGGCCGTACCTG
ACCACGACTCGGTGGCCTGGCGCTATGCAGCGCCATTCGAGGTCGCCGGCGACAACTGCACCGCCTGGGTGCTGCCACCA
CGGCAGGCCAAGTGTCCACGTTGTTGGCGCTATGTGGCCGAGGAGGAGGACCAGCTGTGTGGACGCTGTGCCGACGTGGT
CAATCACCAGGCAACATGCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62