GenePrediction:GLEAN_6034 Details

Name: GLEAN_6034
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:373644..373191 (- strand)
Length: 454
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:373644..373579 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_82:373457..373401 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_82:373346..373191 (- strand)
Length: 156
>GLEAN_6034 class=GenePrediction position=GCSC_82:373644..373191 (- strand)
ATGAGCGTTACCCACACCGTTCTCGTCCGGTTCAAGGACGAGCTAAAGGCAGAGGAAGTCAAAACAGTGAGCGAAACATT
TGTGCAGTATGAAACACATGTAGTGCAGGACTAATGTACTTTCTGGGTCCCAGATCTGCAAGGACTTTCTGTTGTTGAAA
GAGAAATGCTGTCACCCGACAACACAGGTCCCCTACATTCTCTCCCTGAAGGGTGGCAAAGACAACTCTCCCATCGGTCT
CCAGGTAAATGGCTGTTTATAGCCATGCTGTTACCTCTCCATCTCTAACTTGAGGTAGGGCGGCATCACCCACGGCTTTG
TTGTCGAGTTCGCCTCGGTTGAGGATCGGGACTACTACGCCAAGACAGATCCAGTGCATATGGCCTTTGCGACAATTCTG
GACAGTTTTGTTACAAAGATCATTGTCGTTGATTTTGTCAGCGAGGAATACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62