GenePrediction:GLEAN_6035 Details

Name: GLEAN_6035
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:372108..370576 (- strand)
Length: 1533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:372108..371972 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_82:371908..370576 (- strand)
Length: 1333
>GLEAN_6035 class=GenePrediction position=GCSC_82:372108..370576 (- strand)
ATGACCGTGCCAATCAAGCGCGTGGCCGTCATTGGAGCTGGGCCCGCCGGGGCCATTGCTGTGGACGCGCTGGCGCAGGA
GAAGGTCTTTACTCTGATTCGGGGGTTTGAGCGGCGCGAAGGTCCTGGAGGATGTTGGTGCGTGGTTGCTGTCTTTTTTT
CTTTTTTTTCTACTTTTCTTTTTTTCCCGCTAACGAACAGGATCGGCGACACGAGCCCACCACCGCCGCTGACGGGCTTT
GAAGCCCTCGCCAACCGGACGGCCGACCAGCCGGTACCGGTGCCGTCGACGCTGCCGGCAGTGACGCCGAAGCTGGAGCA
GCCACGGTTCGCCGAGTCGTCTGTGTATCCGTACCTGGAGACGAACGTGGACAGCCTGGCGATGGCGTTCAGCCAGGAGC
CGATCCCAGCGGAGCGCAGCGCGTGGTCGGTTGCGATGCACGGCGAGGACACGCCGTTCCGGCCGTGGCGGGTGATGCGC
GACTATGTCGAGGGCCTGTTGAGCCGACGTGGCTACGAGTCCGTCTTTGCGTACGGCACGACGGTCGAGCGGGCGGCCAA
GATTGGCAACGAGTGGGAGCTGACGCTGCGGCGCAGCAGCGACGACGGCGAGGATGCGACGACCGACTACTGGTGGACTG
AGCGGTTTGATGCTGTCGTCGTGGCCTCGGGTCATTATGCCGTGCCGTACGTCCCGGCGATCGACGGGCTCGAGGCGTTT
GCCCAGCGATGGCCGGGCAGCGTGCTGCACAGCAAGCAGTACCGCGGCCGCGACGCGTTTGCCGGCAAGCGTGTCGTCGT
CGTGGGCGCGTCAGTCTCGGCGGCCGACATTGCCGTCGATCTCGTCGGCACGGCGCAGTCGCCCGTCCACGCCGTCGTGC
TTGGTCACGTGGTCAACGGTTTCTTTGGCGATGGCGCCTTTGGCCACCCGGACATCCGGAAGCAGCAGTCGATCGGCCGG
GTTTGCGCCGACACGCGCACCGTCTTCTTTGTTGACGGCTCGTCCGTCGCTGACGTCGACCTTCTTCTCTTCGGCACCGG
CTACTCCTGGACCCTGCCCTTCCTGCCACAGGTCGCCGTGCGCAACAACCGGGTCCCGGACCTGTACCAGCACGTCGTCT
GGCAGCACGACCCGACCCTCCTCTTTGTCGGCGCTGTCGGCGCCGGCCTTACGTTCAAGATCTTCGAGTGGCAGGCCGTC
TACGCTGCCCGGCTGCTCACTGGCCGCGCATCGCTGCCGCCGCTTGCTGACATGCGTCGCTGGGAGGCCGATCGGATTCG
CGATCACGGCGACGGCCCCAAATTCACGGTCATCCACCCCGACTTCGAGGAGTACTTTGAGACGCTCCGACAACTCGCCG
GCAACGCTTCGCCAGACGCCGGCCGGCCGCTGCCTCCTTTTCGCCAGGAGTGGTTCCGCGCTTTCATGGACGGCCATGAA
CGTCGCAAGGCCATGTGGCAGCGCAACAACGAGGCCGCCGTAGCTGCACGCGCTCCCGGTGTCGAAGAGGCTCCGATCAA
GGGTCGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62