GenePrediction:GLEAN_6036 Details

Name: GLEAN_6036
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:370036..368367 (- strand)
Length: 1670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:370036..369170 (- strand)
Length: 867
Type: CDS
Source: GLEAN
Position: GCSC_82:369120..369049 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_82:368979..368882 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_82:368829..368745 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_82:368687..368367 (- strand)
Length: 321
>GLEAN_6036 class=GenePrediction position=GCSC_82:370036..368367 (- strand)
ATGGAGTCCACGGTTGTCATTGATAGCTTTGCCCCCGAAGAGGGGGATGTTTCCAAGGAGGCACGCCTGACTGCATTTCC
GTCAGAGCAGATTAGCTCGTCCAGCGACAGAGAGCGACAGAGAAGGCTGGTGCGAAAGCAGGACCTGCGCATTTTGCCGT
TGTGTGCGGCCATCTACCTGCTCTGTTACCTGGACCGGTCCAACATTGGCAATGCCAAGGTGCTCAATGCCGCCACCCAC
GACGACCTGCTGTCTGACACAGGCATGTCCGCGTACCAGTACACCATCGCCCTGATGGTCTTTCTGATCGCCTACGCCCT
CTTCGAGGTGCCGTCCAACTACCTGCTCAAGCGCTTGCACCCGAGCCGCTGGATCGCCTTCCTAATGGTCTCCTGGGGTG
CCATCACCATGGGCCTGAGCGGTGCCCACAGCTATGCTGCCGTGACCGTGGTCCGTCTCTTGCTCGGCGTCTTTGAGGCC
GGCCTCTTCCCCGGCCTCGTCTACTACCTCACCTTTTGGTACTCTGCCCAGGAGCGATCGCTGCGCGTCGCCATCATCCT
GGCCTCGGCCACGCTCGCCGGCGCATTTGGTGGCGCCATCGCCTACGGCGTCGGTCACATGAACCAGGTTCGCGGCATGT
CCGCCTGGCGCTGGCTGTTCCTACTCGAAGGCCTGCCATCCCTGCTATCCGGCATCTTTGTCTGGTTCTTCCTCCCGGAC
TGTCCCGAAACGGCCGCCTGGCTGTCGCCGGACGAAAAGGCCTTGGCCTCTCGCCGCGTCGCCCAGATGAGTCTGGCCGG
CAAGTCGCTCACCTGGGTCGAGGCCAAGGCCACCCTGACCGAGTGGCGGCTGTGGATGCATTACTTTGTGAGTCGACGCC
TCCGTGCCTCCAGACTGTCCCGCTGACCGGTTATAGATCTACTTTGGCATCTCCACACCCTTCTCTAGCCTGTCTCTCTT
CACCCCGTCCATCACGGCTGGACTTGGCGTACGTCGTCGCCGTCTTTCTATTCTCTCTTTTCCAATCGGTACTGTCGCCA
CCTGCTGATACTACCAGTACACAAACCTAAGAGCCCAGCTCATGACTGTGCCCCCGTACGCTGCTGCCTACGTCGTCACT
TTACTTGTTGCCTGGTCGGCAGACCGTTTTAATGCGTAGGATCTGATCTCTCCGTTGCAAGCCACCAGTTTGAACTGACC
GTCGTAGACGTGCTCTCCACTCTGCCCTTCTCGCCACTGTTGGCGCTGTGGGATTTCTCGCCTCTGCCGTCCTCCCGGCA
GAAAGCTACTCGGTATGTGGGCCACTCGATTGAGCGCGATGGTCCTTTCTCGCCCTGACAGAATTCTAGCATCGCTACGG
CTGCCTTATCGTTGCGTCTTGTGGTGCCTTTTCGTGTATCCCCCCCTTATTGGGCTGGCTGTCCTCCAACGTTCACACCA
CGGCTGCCATTGGCCTTGCTATTGCCCTCAATATCTCCATGGGTGCGCCGGGTCAGATCGTAGGTGTGTGGATATACAAG
GCCGACGAGGCCAAGATCGGATACCCAACAGGCCACTGGACCAACGCTGGCTTGCTGTTTTTCGTCGCCGCCGGCTGTCT
GACTATGCACATGTACTATGTTTGGAGAAACAGAAACGGTGGCGTCGACGGTGTAAGGTTCAAGTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62