GenePrediction:GLEAN_6075 Details

Name: GLEAN_6075
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:142191..140819 (- strand)
Length: 1373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:142191..142047 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_82:141984..141946 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_82:141159..140819 (- strand)
Length: 341
>GLEAN_6075 class=GenePrediction position=GCSC_82:142191..140819 (- strand)
ATGGAATCCTCCAAGCAGCCCGTGAAGTTGGTCAAGGTGACCCGTGTCCTCGGCCGTACCGGTTCGCGCGGTGGTGTTAC
CCAGGTCCGCGTTGAGTTCATGGACGACCAGAGCCGCAGCATCATCCGGAACGTCAAGGGTCCCGGTAAGCAAAGCATTC
TAGACGGAGTCAAGCAGTGGGGGAGGGGCTAATAGCGTTTTTTGCAGTCCGTGAGGATGACATCCTGTGCCTGCTCGAGT
CTGAGCGTGAGGCTCGCCGCCTGAGATAAGAAGGCGGTCGTACGAACGTCAAGGAAGGCAGAAAACAACAAATCCATATA
AATCGAAAAAAATACAACATTTCTGTGACGATGGTCGACGTGTCGGAACCATTTGCATAGGCGCCGTGTGGGTGGAAAAT
CGGAGGCAGGGCCGCAGGCTCACGAAAGGAGGCCGCACCATGCGACTTAATGTGTGCGAGGGCGCACACGTCCCGGAGAA
GGAGAGAACCCCGGGGAGTCTGCCATCGGGCTCTTGCTCCCTTTTCTCTAGGTCCTCTCTTCTGCTGCTGGTTTTTTTGC
GATACTACTATGTCCTTTTTTCGTTCAATGGTTCAAGTTAAGGAGAAAAGCCGAAACGAAAAATACTTGATTAACCAAAC
GCCGTCTTTCTGTCCCATTGCCGTGAAATCGATGCGACTGTGGAGGACTGACAGGCCCCGGCCAGCGAAGCTAACAAAAA
GCTCGCGCCGCACGTGACGCAGCCTACGTATAAAATTCTCTGCACAGAATCGCAAATCCAAAAAAAAAAATCTTCTCTTC
TTTCTACCTGCTCAGACATCTAAACAAAAGGTACAGTACATTTGCCACCCTATCCTCCTCCCCTTTTCTCTTCCGGTTGA
ATGATGCATAACTGCTTAGCACTTTTCTTTCATGATTTCCCATGATTGTTCTCATACACCAAGATCTCTGACAACCAACT
CCTCTTTCACTTGTCTCTTGTTAGCTTCTGCTTTATGTTGGAATTTTTTGCTAACAGACATTTTCGAAAAAGGTTCTCTA
CCACTGCAGGTGGTCACGATCCTTGCATACGTAAACATGCTGGCGGCGCCTAAACCGCCCCAGGGCCATTTCAACATGCT
GTACTTCGCGGCAGCCACGTCGTATACGCACAAGGACTATGAGGCGCTGCCGGCACCTCTGCCGCTTTCACATCTGTTCG
CAGCGCTAGAGGCGCGGTACAGTGGCATTAGGGCAGACGTGCTGGACGCAAGTCTGGTGACGATCAACCTGGAATATGTT
GATGTGCCCGGCGAGGACAATGGCAGTGGTGAATCCGTCATAATTCAGGAAGGCGACGAAGTTGCCATTATCCCACCAGT
GAGCTCGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62