GenePrediction:GLEAN_6077 Details

Name: GLEAN_6077
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:128564..125900 (- strand)
Length: 2665
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:128564..127847 (- strand)
Length: 718
Type: CDS
Source: GLEAN
Position: GCSC_82:127774..127400 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_82:127337..127207 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_82:127147..127096 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_82:127039..126984 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_82:126936..126325 (- strand)
Length: 612
Type: CDS
Source: GLEAN
Position: GCSC_82:126269..126111 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_82:125938..125900 (- strand)
Length: 39
>GLEAN_6077 class=GenePrediction position=GCSC_82:128564..125900 (- strand)
ATGGCTCGTCTTCTCGAAACTCTGATTGTCGGCTCCCTAGCCGTGACATCGCTGGTTGCGGCTTCGCCAGCGGTGGTGGC
TTCGCCGGAACTCCCCGTTCGACTGGAGACACGCAGTCAGCTGTCGTCCCACCTGGCCAACATCCACCTCGTGTTTGACG
GTGCCGTTGACAGCCTCATCAGTGTGACCTACGGGTCCTGCACTGCAGCCAGCGAGAGCGACGCCCACCACCTTGTCAGC
CGAGGCCATCACGCTGGTGCAGAACGCCTCGTCTGGATCATTCCCGAGGACGTGGAGTCCGGTGGCTGTCTGTCCGCATG
GAGCGGCCTTTCGGGCGTGCTGCTCGGCCGCAGTGGACCGCAGCATACGGGCAACGTGCAGAGCGTCAAACGCACGGTGC
AGAAGAGCACAATGCAGAAGCGCAGCACCTCGCCGCATTCGATTCCCATGACCAACGCGAGCGGAATCGATGCCTGGGGC
CCATGGTTTGACGGCGTGGAGCTGCTGAAGAGCACCAACGTCAGCGCCGTGTATGCCAAGGAGGCTAAGAGCAAGCACGT
CGGCATTGTAGGCGCCGGCATGTCTGGGCTGATGACATACCTGTGTCTGACACAGGCCGGTATGACCAACGTGGAGATTA
TCGAAGCCGGCGAGCGGCTGGGCGGCCGTGTACACACAGTCTACCTGTCAGGCGGGCCGTTTAACTACTCGTACCAGGGT
GAGATATCCTGAGCGCTCGGAGGAGGGCTGGGGGGGCAACATGCTGACAGCCGATGTTCACAATCATCAGAGATGGGACC
TATGCGATTTCCCACGACCACCACGCTGGGAAACGAGACGTATAACATCTCGGACCACCAGATGGTCTTCCAGCTGGCGG
CTGAGATGAACAAGCTCAACAACTACGACAAGAACCTGAGCGTGGACTTCATTCCCTGGTACCAGTCCAGCAAGAACGGC
CTCTACTACCACAACGGCATCAGACTGGCCGACGGCATGCCGCCTACCGTTGCGCAGAAAAATGCCAACGCGTCTCTTGC
GATCACAAAACCCGAGGATGCATCTACGACTGCGTTGCAGGACAAGGTCGATGCCGCTCTGCCAGGCGATGCCTTTTATG
TTGCCATGGCCCAGAACATGTTCAAGGCGCATCGCGAGTGGATCGGTGCGTTTCTGATCTGAGGCGAGAAATCGAAGATA
AGAAGACGAGAGCTGACAGTTCTGCAGGAAACGGTCTGGATGGCCTGCCGGGCAACCAATGGAGCGAGTTTGCCTACATG
GTGAACTACCTCAAGGGCAACCTGAACGACACGGACATTGTTAGCGGAGGCGACTTTGCATCGGACTTCTGGGACACGGT
GAGTTTGCGTAGCGCCTAGGCTACGAGTGTGGTGATGGAGATGCTGACGCTTGCCAGCTGTACGAGGGCATGTACTTTGA
TGCTACGACATGGCGCACGATTGACGGAGGTATGTTGAAATTCATAGAAAAAGAAATGACAGAACGACACGCTGATAACA
GTCAGGTCTTAACCGGCTGCCCCTCTCTTTCCACCCTCTCGTGGACAATGCGACAACTCTGGTAAGCTGCGCCGGCTTTA
CACTTCTTTCACGCTCGTGTGCTAATAGACCCAGAACCGCGAGATCTCGCGGGTCAAGTACAACGCCGAGGACGAGACGG
TGACGCTGCAATGGCGCGACAGCTATCTGAACAAGACCTTCCAGAACTCCACATACGACTACGCCGTCATTGCCGTGCCC
TTTTCTGTCATCAAGCGGTGGCGCTTCTCCGATTTGCCCGTGACCATGAGCAACGCCATTACGCACGTGCCCTACACGGC
CGCCTGCAAGGTAGCTCTCGAGTTTGAGACCCGCTTCTGGGAGCATCTTGACAACCCCATCTACGGCTCTTGCTCAACGT
CCACCGACATCCCCGGCATTGGCTCCATCTGCTACCCGTCCTACAACATCAACGGCACCGGCCCGGCCACGATCCTGGGC
TCCTATGTTTCGGGTGACCAGTGGGGTGAGCACTGGGTATCCGTGTCCGAGGCTGAGCACGTGCAATACGTGCTTGATAC
CATCATTGAGATCCACGGCAGCGTCGCCCGCGAGCAGTACACCGGAAAGTTCAACCGCCGTTGCTGGGCGCTTGACCCGC
TCGAGTCTGCCAGCTGGGCCTCGCCCATCGTTGGCCAGCACGAGCTCTACCTGCCGGAGTACTTCAAGACGCACAACAAC
GTGAGTCCTCTTCGAAGCTGAATATCTTGTCGCTCCGAGTCTAATACATGTGTAGATGATTTTTGTCGGAGAGCACACGT
CATACACGCATGCATGGATTGCCTCGGCACTAGAGTCAGGTATTCGCGGAAGTGTGCAGCTACTGCTCGAGCTCGGTCTC
GTCGATGAAGCTAAGGCGACAGCCGAAAAGTGGATGGCCCGATGGATCGAAGTGGTGAGTAAACTGCTTCTGCAATATCT
GTGGGCTTTGCTAACAGTTGGCAGTGATTCAACAGGAACAAAGTAAAAGTTCCGCTCAGTTTTACGCGAGCCAGCTTCGG
TTAGATCTTAATAGGATAATATAATAAAAAATAATGTTGAAATGCCAATTGTCTAAACCGCTTTAGCATCCACTTCACGA
GCACAGCTACATGGCCGCGCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62