GenePrediction:GLEAN_6078 Details

Name: GLEAN_6078
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:121148..119623 (- strand)
Length: 1526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:121148..121062 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_82:121004..120333 (- strand)
Length: 672
Type: CDS
Source: GLEAN
Position: GCSC_82:120282..119623 (- strand)
Length: 660
>GLEAN_6078 class=GenePrediction position=GCSC_82:121148..119623 (- strand)
ATGACCGTCCTGGAGACTGCTGAATCCAGATCGCCTAATATGGAAGTTTCCGAGAAAAGGCAGTCGTTGTCTGATATATT
CACAATCGTACGCCCGATAGACTCTGCTTTTCCCTGCGTTCATGACTTCTGACATTGTTTTTAGATCTGTGCTGGGGCGG
CGCTTATTTCGGACGGCTACCAGAACAACCTGATGACTATGACGAACGTCTTGTTCAGAAAGGAGTACCCAAAGGTGTAT
GTGTCCTCGGTCAGCACGCAGGTGTCCAATGCCCTTCTTGTTGGAGAAATTCTAGGTCAGATCATCGTCGGGCTCACTTG
CGACTACATGGGTCGCAAGACAGCCATCATTGTCACGACTTTGATGATCGTCTTTGGGGGGATCTTGGCAACTGCGTCTC
ATGGAGTGACGACGTTGGGAATGTTCTGGATGCTCACCATTTCGCGTGGTATTGTCGGCTTTGGGACGGGAGGGGAGTAC
CCAGCTTCAAGCACGTCAGCTTCGGAGGCGGCCAACGAGCATACGCTGAAACGGCGTGGTCCCATCTTTATCATGGTGAC
CAACCTGCCCTTGTCGTTCGGGGGCCCGTTTGCGATTATCGTGTTCCTGATCGTGCTCTCAGCTGCCGGCACCGACCACT
TGTCGACGGTGTGGCGGGTCTGTATGGGAATCGGTGTCATTTTTCCGCTGTCGGTGTTCTACTTTCGCCTGAAAATGCTA
AACTCGAAGCTGTATCGCCATGGAGCCATCAAAAAGAGGGTTCCGTATCTTCTCGTCCTGCGATACTACTGGAAGTCGCT
GATCGGCACATGTGGCGTAAGTCGGGCGGCACCCAACGTATTGGACTGTTGTACTAACCATCTTAGGCCTGGTTTCTATA
CGACTTTGTCACCTTCCCCAACGGCGTCTTCTCTGGTGTGATCATCTCCTCCGTGGTCCCCAAAACTGGAAACACAATTC
TCCACACGGCAGAATGGAACCTACTTCTGGGCATAATAGCTCTGCCAGGCGTCTTTGTTGGTGCCTACCTATGTGACCGC
CTCGGACGCAAGAACGTCATGATGCTGGGGTTCAGCGGCTACCTTATCTTTGGACTCATCATCGGGTGTGCCTATGAGAA
AATCACAAAAATCGTCCCGCTTTTTATCATCTTTTACGGTATGATGCAATCGTTTGGAAACTTGGGTCCCGGAAACATGC
TCGGTCTTCTGTCCTCGGAATGTTATGCAACGGCCGTGAGAGGTACATGTTATGGCATCAGTGCAGCTCTTGGGAAGACG
GGTGCTGCCGTGGGAACCGAGGCTTTCACGCCCATACAAACTCATATTGGCAAGCGGTGGACTTTTATTATCGCAGCTAT
TTGTGGTGTTGCGGGCATTTTGGTGACGTATATCTTTGTACCTGACATCAAGGGGGATGATTTGGCCGTCAGAGACGAGC
AGTTTCGAGAGTATCTCGCCTCTCGTGGGTGGGACGGTGAGATGGGTGAGGGCGACCTCAAGGCTCAATCTACGGTAGAA
AGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62