GenePrediction:GLEAN_6081 Details

Name: GLEAN_6081
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:106814..105786 (- strand)
Length: 1029
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:106814..106602 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_82:106519..106138 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_82:106056..105856 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_82:105799..105786 (- strand)
Length: 14
>GLEAN_6081 class=GenePrediction position=GCSC_82:106814..105786 (- strand)
ATGGACGAGCTCAGAACCATTGCGTATATTCTGACGGCTGGTGGTAGCTGCAGGGGCCCTCATGGGATCCAAGTGCTCTA
CGAGAAGGACAATGAGATTATTGAGGAACTCTTGAACGGTTCGAAGGTTCAGAGTGAGACCAGCGTTGGCTATGGCATCA
AGACAAATGCCCCCATGGCTTTTGGTATATCGTGCAGTGGAGATACTGAGCAGGTTTGCCTTCCTCACCAATTCTTGTCC
ATGCTGCACTCTTATCGACCATTGTACTAACATGGATCCTATGATCTGACAAAAGTCATTCGTCTTTTCCGTCGACAAGA
ACAACAAGATGAAGGCTTTTGTCTTCGACACGGACGAAGAAGAGTGGGAAGACTATGACTTGGGTGATGGAGCGGGCAAG
GCAGAGCTGCACGCTCAAAGTTCACTTGCCACCGACAGCAGCCATGACGGTCTCATCTCAGTCTTCTTTCTCAACACCAA
CTGCAAGCTGCAGGTTCTTCAGCAGAAGCTCGACGGAAGCTGGCATTGCGGCCCTGAGCTGGCAGGAGCGTCTCCGCGAC
CCGGAACGCCATTGTCCGTGGTTCCGACGGATGACGACACCATTCTTGTCTTCTATCTCGGCCTTGACAATACAATGCAC
TACCTTGCACACAGCTTGGACTCTGACAGGTGGCAAGGTACGTGCTTCTATCTTCGTATTAGAATAACTCCGGTGCTGTT
CTTTGTGCGCCTCCAGAGTACCATACACTGACAGACAGACCATCGGTGGGAGACTGTAAAAGTGGATGAACCCGTTCAGC
GGTTCAAGGTCTCCCTCGACACAGAGTCGGGCCATTATGAGGCGTTCGTACTGGCCAAAGGCCGTCTTCTTCGATTCGAC
GGTGATGGTCCGCGGCAGGAAGTTGGGCACATGCAGGGAAAAGAGTTCATCCCAAGCACCACTGCCCAATCTGTCAAACG
TACATTTCTTACCGGAGGACCCGTTCTTCGTAATGGGCGCTTCATCGGCTGGCAGGTCACGCGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62